
%pdf-1.5 %���� 1 0 obj <>>> endobj 2 0 obj <> endobj 3 0 obj <>/extgstate<>/procset[/pdf/text/imageb/imagec/imagei] >>/mediabox[ 0 0 595.2 841.92] /contents 4 0 r/group<>/tabs/s/structparents 0>> endobj 4 0 obj <> stream x��]k�,7�_���y&h��o��j�d "���e�!ȋh������3g���tw#d:�l�����\_�\�o��������������� ���?�f��3�&n��ona���ͽ~���_�~���������o_������7/���j�xu����藿q��_ṷ���������l �qb��q���|����?c����6���nx������n��������o�g�ec�#�n)����_����bo��w����_���7�1v�m�li�aj�(f�d%ބw- ��f�q ����*��k�����ܾ�g�xǻ����1�}q\� �u���t�ʒ���#г�i��c���׿�8�����$�;����8���}ld����,rr���3"���x��7ξ���(�n�ߌ���d���7�h�a����`l�c������r�3��;��! ҫ>�j4ޢ���%��fja[)%v(m�<� ����r�&�*qr4���j��}c$�� �� ]侀)vp(#�d�����c�5�,c|�ѵ ��,�k��f������/��ܵ��ω����q;o���v��(���h)���8��ԍu�q7:�"��c��b��] z��/�n|vۏ���)��� )��$@� @�4�΋t���f�� � g��|#��/ � ��nfh d|s����u#��f��mt�&�5���d"#h�,a�z��d��c �0_r�w έ,t��,��a�io�q��gt�<*�`���8i`�üq��j #���/��p�t��>zb��8��$õլ�0d�b;��d��a�@��由��[������x\��w0�(�j ����^�q@r�j��1�(��x!#���c�t�2bt�p=v�\��р�� ��(_�w �j�e��`b��=f%@]ˆ�4�$*r� qkdg��ˈ �g!� ?��&�@10�f{��/ ��wj��2(a� ��y}l������'1���jj˞��d�t����-�ę�"#���`om�0�k"e 19�pp���˷�h|q(u�%��(��{�l��:���z�� �����k=�y���؛h�[����_t}s<�����bܪ�oh2k�'�}h��o�yx��޽�$��e7�'�yzn�:�7��xj���i�e�{f ��jy�c#�ȋ4 ���0-�d ���i�w��^��m���a��_*1p�b4��w�[��v�b���;h��`i�un�kb�� �[vk(ґ��j��e�\�� �=o�"�yu3q6� ғ�2�1iap j�����a�r�a4��*�8x ��b���8 j-�t�sʂdj�� �$)�ب��:� ��zjj�t�ad�5�$�* r\h��a"�0)=�т��q�cv� �2\[�ml��`g��򮣤d������atae/їս������*�c���h-���lc�un1l"-�m���$�w}�rrk؆�c'n ��l.o�f� �8�vv�p��"}t�ec�x��m�g�x�de�j��[ou�ry�ijǭ�ry�ij%���o�p�@xa-s�k��²��ry�ij%�y��0mb�����ij'���:��q}qy�e 6�-���0*���xbm��f!ғ⊴w��kj�j !������i[bc[���� ��ċta����lh��� ǖ y�0�� pn�frw\�ze��v��w�- qv��brd 3)'@��t�xn�3��&.ϭ� �x�jr��c�'9�x;��x� k�$����ex���<�ʴ��ډm}����r>�k�kx�6 ����m�l��t�����,ij���f[�g�]'�- pxa�/ɉ�l{ђ�2" ��%��kƹ���<[;1�q b�]'�-���oغ�֊���i.{њ�<�:�-xqo],��"�b�%��d����$�^g��4��y�$ ���$�ha�3hyœ�x6��bvl ��f�-l�y�,�@�e���=�u���s� �!��s1��!�y�d��� ~�eǔ��c�ӳ8�rw�5 �ugi����qlil�f�-y�q&.�sr��g!v �xpyl�l� t�b�vn������q�xai|�l?�ɒ\����i�屵x���%5��t��qu���g��$_��&&m��4:�u�ء���\p*%���j\j�%g�pj«9��-ˍsdr�ҍ]��]nt�4 [�d�=hc/���  ;p�s�0���rj'���@��q g�l��e!��"�i��k���rɒ*�nd˓x�e�������[f_��eg�=3θ�(i�c�!��cה�-���c,������#&&1c�-9=�\[�كtai��-]�}w����/[�_�m�zzkw���}�m��r7yie�pmg��ɖ y�h z���v�$��h�wn���$[ɉ�;r��l�"��gi\u�ӣu��.y|��!�# �[�\h����0�ѓ2�t�-��b��v��0z��2� �h�%�f �҃��9j:hi\>:ek �dz]g�x�v.�.l����k��r�訮�<�y(�`��m�r_q�#k��xq![*$�%y)o�v�n�͗ yh��º��;.�f%(��ab]��:�k� ���akbk�,ey� #h���$͖ y�4�x_*d�@ѣz�^����n�%.<ʬn�%���ry���o�~�*��va�td��&si��j"���m�j�m��27��u��w�nȕus $�v��h7 ����ȟ>�y�zq�i�%c�摬���e,n#q]��2�a b� i���t,���j*~ [!i���vķ�1�m j?��h-��k��ryњ�vc��yi�e���xn()%�"��,��k�f�r�a}qy�ij�]�r�x^&�s�i_��&�lc���r� �d��џ(����9�]�te�l �i p�wj��� ��5e ��$�}��k ��c�o-��l�8���b�',�o/�¶%(z����$w��^���%���-|[�iavfxp-����r�rr�%q�ٙkrf�-᪨s��h���%\�ĝ�f;κ��ѓ�m[�sr�亗r�<ί�o�s�y�sf��ķ;2�v =���)�cy/�j��$� ���y�����ˇ-���� �xd:�%u�����\�w,j��c�̓���%i%���*d \�y���׃j�ϖ�^�%v����\r�%��n�6l�5y1ۮ�x��th������[e�i_f½k5ċ���z>�w��r�����k ��&=��b�a�ȷor�ĕ����(�i�,㪰�5��pd���q��1���y���y�=�$^zn���i��ύ_���j� )�n��{{������so�f����k��z�u ��s�?jx{�������������6���6j����úc������=^��\®p�y�� ���1f��n%��qz�j��d���?�o9��쐰�/��e�ans��'�ar�g��gzd@�ܞ5}�u�;��y�[n��!}d�\tg_1r(�<$m�c�c�p��������8��v)y/w����tw˥m�5:�ߝ��.���u70w�gu�v"e�!l��8*�p�)sx�1r���~ �q�ǻ~rtj�@�=�>a�� ����� ��-��]n�p� �~� ���c���9� �>�b!ƒ��7�׉�y��b߽�y f�!�{�������kt��}��7�w��:�n�b~��ø�� ������`�%yx�7lg���³8]�án��%-"p�–��m��u9��v�խ�'��҄p�;�y��҄p����9�$��׭�{���"���bu���2�[�~x�$ew���������rŗ��h��$�뮇��w�/���r �)�3‹�vdx��awz��xg)<"�rfx�)�=8���4j����|�r���}����;?�1��q}���u��ƥ %5 7@��y��x7e�rf�8��t����d�e�^�v�9\�����&��bk^�� ��q�&�(jg�~zh�׎�:� ��ӽl\�ˣ�";�dv�u��.٥&�d���;��m����9�d��n��.�g4���^��o��$��-�y�`���ll����<�jҿz-k��:�d �j)��7�ū�__����kt'�twn�)���� �'=u l��q�bm�t�w����<���y���s�l f_���0հ���1s�b�⋼>�"�2@�p`�o�b��pݾ���bty�o�jw������ڸ8nxb�`����̔8;��ǰ��?w��`�љ8�ұj�h~�kѯ����wg�)5pu·�k��e�!hk�(9f>��'��)(�w�̡ ϕ�� �gt���!�!:�p� ���\q��0��rw���#��-���x�w'�,�b� �n��k�z*�)�xj�� �wnn�}'�fg� 4ߞћ�.=���|�5���/��ce�����6����tt �},yˇ�����snj[f��9�r>w����@�թ:nj.4z������,)�b���y�҄�%�<�>-t��ɻ���s�fiitso�{lag��u�d��&�?}��b����&��y�i�����ѽ���z͆��: endstream endobj 5 0 obj <> endobj 6 0 obj [ 7 0 r] endobj 7 0 obj <> endobj 8 0 obj <> endobj 9 0 obj <> endobj 10 0 obj <> endobj 11 0 obj <> endobj 12 0 obj <> endobj 13 0 obj [ 14 0 r] endobj 14 0 obj <> endobj 15 0 obj <> endobj 16 0 obj <> endobj 17 0 obj <> endobj 18 0 obj <> endobj 19 0 obj <> endobj 20 0 obj <> endobj 21 0 obj <> endobj 22 0 obj <> endobj 23 0 obj <> endobj 24 0 obj <> endobj 25 0 obj <>/extgstate<>/procset[/pdf/text/imageb/imagec/imagei] >>/mediabox[ 0 0 595.2 841.92] /contents 26 0 r/group<>/tabs/s/structparents 1>> endobj 26 0 obj <> stream x��]k�#� �/��a���]�b����4ĉco���c�>�@�c�~ȫn�f�t�h8����r}�b�m���n�>}����t2�?��i<���;��9w��ˈ's^�a>����w������/��}�� ����������el�˧lg��˿颯s�������%�/�~���o;���8}���w3��_߿{-k�=�qv_״�&���<��&�|s�v]dz=�w� �[0�oo1��o��邈p�s����i��͇�����_>��c�6���y�id3�,�f�s� q�� z"p��k�tz��s�����\��7vl��'�`�o t���|糀��앨e]��i�z���m�0ϼ�.aoҕlf"� bo&��5���<5��n1)h7��y�4�d-0�2�3��lb���@���3t�i|��ny�8ބ䝚\��$zbwkyy������br�8ީ�hn��x��/f�=ө�jk�ro*b�o!q���@�~��!2)��m}a��я��3k��;e��l��ka$�����x��z�� �ɒ��8ko~qd0�di� ������a���w��/ �b�� �ۃ�c��h��р�tvn)w�_k�9�b���a �v�[4 -�o:���&� x �����6���:���xp � w�k�߀�ck�8�;� l��r0.�/"r�nm��"�0�u��4flp�5_�����rz��׏���݄3�o�s@��@�s��x^p�b^i��do���l��5n\�z7�.��u�bm��������h ;�$���l��v�y�[���j��n��uqs4y-ui�k�g��[6��s���pi[i�����]%4�xߙ�jh��uz �y�r��]л�� ��m�} ��w�����0 �i� (�0�by�r?z�� ����}�����a�z͔랱�x/�_/�� j�v�/یt�69f���k�ko){��hj�� �.��2}��a(� ��d��v(�n��:zc#[��hbc#��gh�9e�(�5�r�z�&��.�}$g���� no�ݤ�-i��4[��d :��(�sy��b��g�c�f�<���:�n� �����s�]nj�k�|����u��f�hs�5�h)�[yqn1d�c���;}.i�y�uw �m<�7����~p�=g5����]ܩf$?z�.|��p �"� ��� ���w�p�eb���� �zx��xc�rl�j- c9jk� �3;� �zlu��i���u�dc;�-հ�h�$*m2�[�ղp5�����b�e��g��5��#�mkhu���agϗ9gr��ۭ��x"rog��-4z�­�'�i ���ty s.oc��>j�d��m]b������5`i�!�����j��78� x^-q�y�z���f!����e���p�m�ثe�b�� @ve謙bo#��<ģ�zcl��0�_�j�������sv��4}���?�fd�ki�� б�]-�h�\��f��^��i��e� l����)�b���7�h%f�4����lfu$uʶ� .�߬��h�ג�b�a⤶y�,~o��� y)��m�����6��u�bmk�t��v��(�:-ub�)"��by5��ş�}2�s���xn�t�m���jr2�-*��p�n��l�] �z�%��q�͠�2�t%je�f�fmφ&�&7���d ��z��a-ꅶx1���u dڑ/�<hp���s� �v9�zx�7���\k&u>x���c2�l��� �c�9�`c��q�bk��э q��l�!ۣ4ފ2���h�hz��a����յ ��=bv�ɠw�?�� ��lմøy�>�jȴ&hknv�~�����ͥ������°���� ��q��$�oy����^�$�xk�u�$��qz����õ'��u}�����*��,��clv�i㠻�ܓ�t7���5����fq �j4��]��#��u׫@i�u0�c��� �m�mb�r�x� d9m `"{p�s�e����m?��k���mx���#�d6��g1���@"ދ;��c�oz;����lq�/� �b��ֆ@���n(v��k��u����zi���-�k k���}4�ml�������z^"3��l\e-?�f�"ki���y��o���@s|o� �fm\��s[ie�qyj��v �d�����u▴*�8�(�hu1$�.\�/[�`� 5p���y�ג9i ����)�v v�r�6�p�=�m�$�g�ck[���҄&wf��-4z�1h�y i� ��$nn��2�2�tvғ͖l��6���$�uq���&��^cc��t�`qf�kl�e��#/�l�ԓ���h�f�6 f��-�q/��y-h,9 �u�դ:i�h�๕��f�>�������[h�$;w��@c��6ki�� 8x��zh���u���k���]��� &�-��ռ��i�ږav�.rs���r�k �^^��bt�om�9p n&��$a:���v��� 8���bh�r�i7>v^$�e�!� .��5�y����z)g.n�oj ��y扥���n>@15!��'��r`��9�qv��/���sx��%���i�ع$��3��n�@cҹl��@gd��2p��:`�o�_0j1�k܅qr�����p��� *�¼��5t��� ::�h���q���n0ji7 k���yyz��'�2l���ͳaƨ^��<*�s/���ε漫c7�#s@q���j? α�:p���o�9��������pyw�����v�skv����ߵ��������q�$�d�0?%z5�p�`��d�� ���9�p�`�ѐg#��3hk}�� �[5�do"���]ínye�7�\]��&��¯#r@/a@�y��� y��χ p[m ��j�s&�&.�������.�a֎���o�y��mڕk�d�����w��0�rpu?1���d�h��q2 �4sn���y״�&�su%xlh��6|9hp`l��d���\��2��,���"jmѝ��p�j���v��|œ͔►?��lcρo�y)w�|$$x��@��f�l�rv���m�&���#.��*j������������ip��(ik޻z�w*#un��}�6ن#��kp8za��5e;��k�-gv��[5�f�� �n�����)�}xǫ(��!3;�k��v�ӂ: �4��"�'��c-,p�䙝�� �k":j�g� h���ri�qs9�s���g�t� �pa�p���ր л!s/�bx�o!�a2���k��hh^m� f,jd�c�x��;ۇ^m\�37 �a?p�jb6�f��w"#g�mhz���x���6)}y\ք��8x� b ڱ��6�{�d8ž����rb�o�v�h(зhgli�o4��a`_{z��0�a�67��|��ߦy{w�#�pey��/p��[ݬ�!�v��<"[%g��ժ ��>��γ�c����ڵ}���y�1n�n@�o26�� {�ћ>�����a�w3`i�k^e;����w<� ����$7�w��w����d%�d������zx���^����?���h}q_�/�x=�6���ȍ�&^mb�~am ϟߡd#�x��j���<����j���"�}���x4�x�-ڑ|'��s���׫�|{i����m�����=�m�o�\��"�m�6�,qk�>��t�z/s)�0�o�d�>o�p4�r������bfu=2�j��8 v��e u�=!��d3��m�ڦ��;p���ŷ��¶bǖz[t|���b�w~َe�_�����8].��x�(��f�9�\s�j,[k�,��r�ۑ��`v�ae���n5��d_7q�u�� ro{�$�;��$6��(��5��������qk`쌿%�[���������y�\gd�u�6ӛ|u�&˴�hiܵ@��h�v�e��,q��c#�z�[m"i��d]ԅ�< l��^��vk)�;pb�wn�r��՜�i��sz��\94���k�^�l��;���e(} t��t�;db�m/%,o��ڞk����u�����{gmh�! "�y96ل�f/ת��5tڄ�vx��ة��elw��ù2�dw�-��su��&h5�:�qh��y4�s�oo��e�����&f����y~<��������#avi�$x���>c���r�zoe���navs�me�|�p��2�e$�m2���[����� td|�zk�gm^́l�*imh��l ʚ�j�q��9݂�5*q3ű�p6��-;p�,|( �� <&���yԕ��<��e����w��)���%����@~���c:@�sxz`b}%��f���j�'w�����_�9�_��i%{���o��������.)��}���e�b����uu�����< endstream endobj 27 0 obj <>/extgstate<>/procset[/pdf/text/imageb/imagec/imagei] >>/mediabox[ 0 0 595.2 841.92] /contents 28 0 r/group<>/tabs/s/structparents 2>> endobj 28 0 obj <> stream x��][�$�~?p�üց�ui��jbh��<�<�`�)�8�����sm�z���zǣi}-�����|�����ۧ��旅���0l��?�/��3��m*}r��x���ח������������ї/?ӏ����;�ީn�×ӡou�忯/�g��㷯/?��io8z��t�������e������x4�3�obq�����ޛo�i�1��zx �]�i��a2��q0^�:�ߏ��ن��?���_~����~���3�ں�0�:t��p��>*-���ȕim��|��t�h8�������={�n� ��v{��r����������;��r�щh҄�?b|�q�8�h�� ��q�k=i��� x&�b�cpuq�}:1�u� ǡ��j�����%�zg���uzj�u�8-h|�k����rf�t���az(��qһ:4�9.sc?��j��б� �d�tc��.h$��"i=d��!ld�aq��̠��w�ѳdr��8���h�6�,��z����fۡ�`"��v�l���y�cʵ2�\g���։���ю�h�xyԝ� x ���)�ԅ�e{�����ֲ���9bf[ȥlm��5d�� �b�ис���)z��} ���n�a��и�g��̃s�zv�xp�o�r0\ !�1�`a3�uz�� �l!tw3 &�4�h)�,[u4�7#�ũ�8�!�(�i��olt��eez�����6�cjq{8i��l }>�)�f&m�з�j�1� �u1wx��g���(�hg~֊i#�h�e�j�������y�o�w�(�?�|��g$g�}�76� �kڼ� �&_�*}�k�]��j��� }v� �yť�g�!3�am��>�va���g;vv4h�'� o"oj�t���a!� �e� ��qeݲ�z�f�� �s�#�s��a�x������6��heh�<�h��$|։o��ch�xѓ���rs���q��h� �i"�z�lz���h���yt�#��5g�{rrq���#ijg�^�����<����2�e ,g6h�0g�6^��q�w�������b\tvf'�sf'�s9�hg&3�ru�&�o/��i���c�"�=;����!��?�z&�\�2a�����<�^cy�xú�$�ac���3zv����v�o#b�[�zӏ ��6ϡ�b��΄�2�ydn{pja��yv�,0��)dk����� �cpv���dn�g^���h��u8������w~ɧ��۠"g ����­�8�y��qc�rܸ��%/r,������#eڧ�*��;jg��iǔ�d���t�=�#�r)qց53h���޺z�v�^�='�9�sv������^�s����@�a��d)3�|ϲݰy94��e��4�ndl1�!�*�ȕҁ*�/1e���e�5���\�b��¼���o�ŭ8a��h�q�mi~# �z{ qrs����yx�y1������o�b�b}λg�����)]�;9��q=uu���즍me��d�m���c�@�� ��cu9r%�z� ř�ږm$�蒒��r�����*z1w�!�@ �-_�jk �u��-�|����b�l��k!�s��j���� ��h΂ڰf�������qr��v��u|���vb1v�u$�w4�|߾p�˴��$��>��w�i�x��p5xge��,1�4n�wkzs, s,�t��s�d��|mi���s � � �r�ܐ�ucs:{9���z ��&gc��o��\9��t.k4v�"an��&p���ԇ�ù�h`���5 9gv���lq �x�m�b*h8{�\�u�˞5���qum u��y1�n,uw���>�� 4b�,��faa�j {�r�h�*�d6u�w�x��*�bj���w���jw���5$�;!.��kigg�c�pfm�k!s��s@�����b#�ԭ�;hx�w� ��k��fg�(j����f\v�� ��a����$��<���p�c�\���펆u�m�g]�����-�w`|ۂ!�����p��ɍҽ��� ׌�1-|g�#8b��1r\���բ�2vl��1捾s����xi\�˝{�tu5�r����hk�g���k�h�2����h� gq��rm���: ד:���}-yj� �*~�6&�-$r�y5��h8w��\��`ҽ ����.��m�bj��ӯj��&�1<뚿�udʹc�o�q0`9�r�q�ϩq؜����b1��� ��j��hn��:рv_ו�~v\ݰ/hd�qm� ��⋽�8���o\u�3��km)�w���م��j&��k�j�l� �{�mai�-f^��f]�єj���]prv �)#��rf�or��;업 �y:˵��mpb�y��$� �xc� (�[b.iխ���ku����*�;gvc����b�8n�t/4= z�r �t���{e�����/!e���\��%��%w�� s����ж�i�c�w@ñ� �0�i���(�3��>���~�ŷ�~ܠ���m4�z<��]`��{��s�s%�u�~�j�cm�mr�~��js��i�ftƨ;so[�� 䢘��e�)^���m@g�3q�q�y�|vݙ/�ͮ ����� ����*���3\�������w�a�e[׭9r�s��v���`���b=���=_6�!d�f-�kr'� �d&<_�mu����i�fm��hn����uwv���gp]���i�9� �9k<#0���� j���b�z�mx80��ksř�<�k�†nө�� .��|�s\�������!w�y{��wj���ikk���h��t!�b�x0i��wb�b�r�d��c=�j3աn=�aq�ܛ�wt�h}-,�v��d����s����y �r�?�q�;�i�t�&q�����z��~��.{b�ќ5�w�|�5r”� q,`�w@dc,��;\��^ѩ-��z�6e롵���*;v�ׅ:61����o�7�0�4lb ��� '�p��&d��a��9xn�uy������u�i��*m0�l��p_���x6/�w�� �� ����g;��֐)����h�bm�nݡj��7�kf5?;�}£��6��c�5t���x��6u4;*o@��' ��rz�\q �2>ōk��#1�h� r`�@9��#ք !&�_��z��=:h�c��c�d��:;x��f�0r�� ��qm�t����ں����g�~��p��&}4���bv���u0>�ܚw�b79�q��ե��<��~�87�u�����q�9�#��=�y��_�n=�b>x�dh6�q��1��i�ȍ/��\���.���qf��;�#�i/�b\�a��^��\^er������z�� ��i��^덫����-=�h�qx��u�t:0�?�������$o���� ���uy��ey.fxy�oo�1����i^�����_�@wb���ucҋ�!���.j�idu��@���] zw�8s��j�ӡ2ٺ|�g��$��8> endobj 30 0 obj [ 31 0 r] endobj 31 0 obj <> endobj 32 0 obj <> endobj 33 0 obj <> endobj 34 0 obj <>/extgstate<>/procset[/pdf/text/imageb/imagec/imagei] >>/mediabox[ 0 0 595.2 841.92] /contents 35 0 r/group<>/tabs/s/structparents 3>> endobj 35 0 obj <> stream x��]k�$� �0�����v���x����h� r0rۧ�s��)��{�j�/�0f�ݥ)~z�)r{���˧o���.����0���=��b�@�~���va����:~2ڎ �y��h����x}h�j������������0����[��[���k�at�f0��kȭ]�����q�wt���4�j��̖��j��e��ap����z0b��e��3�0/����ie�k��vf�y�wnm�u�k]�g��� ��|�v�ˀ�3�no� �x��0 �2crd�258"��]s8��s$<��n=�e�u�cp����k��@��ͪpxn���;f���`���n�ם���[y⼜c�l����ž�z��u8&eu�2"��0'j d"f^g2dm�i~rxw~�j��}��~���$�=� ���: 0�9;�p�����qo8�w.v�n�pf���`��> o��-s�=7��i!nf��o*.�"rl��nb<�m����rz��'z^���􅟨��w -�(��x�`���`bv�y��9}��n��يc�z�4{x =} i.�\����r0��3�lo��c��[m�i��mg�(2^ �-2)�7sգ���l��5@j����k-m=� ����œm�ז�b!�aw���6̾�ߢ�rw��?�*�(��t<�,�*ӻ��*�ѻ�x�"� o�6}ce��� ��[�{���]��;��#}[�h<��h��ca��t��ю�*�z�c�q����bb�{�,4�"i!�kvu�dn�u�i �ߠ$ok��]��i�y�]�n)#��.����8.p8���)1m�]���5r�he�`�"�q1m��k2��2�e� k ��$΃�������cʡ�8���ﰍg�,�l�o��an>�3j^�wnf s��l��9�m>��تl��l�����=� �6�g�l�ϩ?)la��n��,ܽ���/n~�h�i�tzw�!��g���)}�xv**�c:�����6��6��f�9�π:k���?l����(��x��� �����{����v��a�u��/{r,}�����$���֫�;p� q�%�����"���íw0�n���&�>{�� �d'�j&*}3�s��.y������ x�x�fʧ5�|�|��m��h�����ad��磏ݚ��&�!'=�� �#d�p�er}9 yz�/�-8�&���z�2�$�fdʈ�s�jh���-�j;��,��l5ur�1�eq�se�#n�d��#�8\(�m>�apdˀx��|�s`yh�����)��p�i�hff�&q�c�u����9� ��c�x�6���� o�5 �>2�c��zzsi}�9��zo��j^�}�o��^m�%�g�ɗp��-��" �g|����ee&iak�z8{��'l:s}-sva�ŭz�x�t��]**����-�@&l����ooɴ�������j�&�tigt���p�&�3���:',)��cf�g �.����y�����/���q�=n��.s�b��z�w����
᎓�5%|q��*p��.&�ωs�c�:r)�z�"�.��� *�ad(q�s6{e��̒o����隼�bk\9����c %ҳbw�7l�t�,��`�s���z����ab�q�&'�' p�$v�̠��������uզ����d���\�m?\}��� �z��b�3��3 �`�t:]=)v��i�qb� ֆk��qpd���9]�����c�c��z��qop��:�<~�}��o��r �=�j���4e�!�ϲ�c%=�=s����;3[6�2z�]�m�ˡ�����'vb��"��i��cv����wi����_�) ��� �k؁�ى����2��� g��in�(y�4�9�)�|no*��e��ן'z�s�g�s:�n��ey]��[��� �k%f�l�b�w)�!\#�bs�n*��xl��t:�t���4v���"�@"�����0%o�kŒ�k.j�sni���ԕ��ڪ�!�i�1�j�,�(54��5k����a*hv����v�jet"� �#)��` !ۮx���*8��q�ן0��4���z��9z�n�n@h���fl���l�j!w��ūil�պ)�|�de�y��mж�iw0o� wrd��еl^o[�l�j씈����mi�sĕwj��ȥ�>�rs����"�r�b��{r>�4�)�o��4�x����'�đ��~��뻶h����ᇯi� ;��rq�j �wi��#¶c��t��h��mg6�j� �w:���p �)ϸ�tpp�����s/web�#v���}n�z ��ɣap���p ���^�>��q�����>��\^�{���wbw��ħ ɯ�'�`s�e&����jc4��>l�dj� �p!���7'��k jm\�м?ej�z�!�ɻhex8)e_�wm���-�݆��]�c{����2 &��ۇ{w��7 ���,7�u�t��{) @&�4�ri/���u��1�g ) nd ȅ�!�!s��6� ����Ԧ���滶���; md�蔂�@%��u"λ�r����f���=�ic��̓=��di�l�x!��vpe��-c2�6-i k�*rh\�t�|x� ��t�r&���q�֬[ rʟs��y8w $b�(vm_.�bz��xwߍ% ��fl��[c���ӭr� ���hs�-b���kdj��|��ikƙy b��|asm�6@[$�ǿ�j�ttg��pfi�>��m�g��h�2�%%朒�]�����%%w0z%%�j.,k�w����5.�]�r.��$g�x�j�g��n��b�$�ނ�7\�\��z�vrm��)�;�oq��b� a�ƣ������p�!�(e�j��adh4����k��q�;)*���k��\��l�# ���8���=�7�0��ɰ͉��jy*��cn���ơ�ҿt��ܕ$��n�k*��n�c��p�x�f�^�b� �ǂ��ky�|��x[]*z�9�y�kת���z]��c;�e�f;n0r������c�}�>�|��^����[p}�::�y�-���[oo�1�77y{�g!=����-�ݐ�7��i���6"/��rskq�t[w��6r/�#s����vkt���wyգvi�� �� endstream endobj 36 0 obj <>/extgstate<>/procset[/pdf/text/imageb/imagec/imagei] >>/mediabox[ 0 0 595.2 841.92] /contents 37 0 r/group<>/tabs/s/structparents 4>> endobj 37 0 obj <> stream x��\k�$� �0��/������x��f�h� r0rۧ�s������*�jf4��]ϋ������u�o�|����o��|�tc���96�\��&ѕ�'&l ]~���������}}|�4����'���_�q>e��;h�]��g}�=����>>ȟ��������<|����f�ο=>��s��[ i�"����m����i<����� �ii0p�b!�,{h���hty��[v�ɜ�0z��8�d<صlx��bb4 asu�3qc}^�ݠs��{��d-�^�����*���k|��b?m�ẁ�h�#�>���2v� s�؈}_y��;21�a ��~ snf�=��z�co�� "�b&�5����g] y�3���0�d�����c��� �[��s�>&�;��lp�*�� �2�e�w��{�*�$�y���xyu�f�˽��zqπ1 ����76 �1���v9��9 ��{���y�@�-�`�1�c�!�d1���΁y]����}�r��/�m,������<��oz�5]�m�وf��*oр�gf�2gey&ܑ����y툑�͑$r ��c�����”y�̶3!u� �'�&gs�ݽ~ʄ�<�b��ԏ�% ��o�k4���i�ۖġ�\��%�6.�tr�m�x˼��0)q���29i|yo�w� s�2p�o��c ,��@\ gĵ�8>p�j(l�r���a������ �ғ�j�:ccqb��ju¹q�̉t�v˲�ӟ� �sg׶�!ߞ�$�1y���z����t2u�r��ˁ)w�\-_l��d\1�4�i0(�n�'����<���u��j=�4hr�4y��]�"���c0����o`�?� cg�u> b> stream x��]�]gun@m���t��l�\z�h�w���;�d�va���w7v������z���g0 �c���q�tn�rd)�t�p��(��j-��j%��"r���=����ܷw���{��͙�3����9��3�( s��� �ua\a�� r��e� [x���� ����:÷e�[[ժ,�)j� [�?�����*t��{e�tie���߬�pĕu���mx��mu���j��qt��}�_bs�қ � ��6��k���8nx� �kw�\��5w�$��;s��)�ĩ�ȱ����˂�&�m��!7؂,����-sua���b5��9e�g{�2�g{����w����b�l�=�������&kb#��� ��n��\��%w�d?[n����k�[�.-��7�o�e�nr����o�”\��nj�{�(���� �f���i�ps�7���{o���x$ �" �x�i30d%�u�h�ǝq@��j��ce��ao��ox<�ƍa�v�q� �<�[��f�ըa�u�2e���\���wf�;p�x20�j3�|�y� (��k �麨��p�y ����a�� 7l���g�1��eö���uq'kgroj2�a�i�/{��v܁ڠ�� ��l��b<`u�� ñ�q �c��ݵ'@�w���z�.3�ڢ�9�.h���2w� �`�« dgq�r�u��ը� ��v/��tr����c�� �ulo%z��u1ϼ~xƚewj��i��ctw�!s�f ��;f�b�y�tp�wq_��_b��%1�̕��ra/,j����nkt��!� hmqp���x4u����ra�t/� �8j>@[�`�z0�%����^�bp�e��f�j(agp� q�:z�`�[��\ň���ac�sb��_4�\�lf���bk�nb�b�@�`�c֑b�{c�>�� �lb� �j� ���q"� �ǻ:1���(��,�i�_�p��q��#b�{h�x�u���`���^�8� .ϥc �a��`�����jxok�;d[5j8�y���j� xc! �$b�� #k j 9���� ��l�*�� �����w{�@�#��$ �1<��bx�3x����w�6�b>-�hct*��a:�p/f� �"p�����8�|t����.�k�}5t1 ���g ���!„��6� �إl9̣6�n�t�� �]�@,f�: ;h��lx�wh8\�������0��6�{�����l`v ���s%jx�a��s�m�"�z�u �[�็�x�u��-���d>(���5p�{�'�� <�<�6�#����k�����:� �i�ܳ��������0�c�k(�f_j� k ��u (�f�`a.v��c�����%�w��,� �s�*j���b}�su|�����x�'`���ԅό�g�"�u ���-�",�x�a?��8�o�3���6h0w������=�:<�#�_ ��ae�妆�#讆�0i<ߡd�q ��%�� #m`����,�,0m��c��-� @���>4f���߷�.d���5t����b%,f��n����݊� x� �fxa��ͱ���h��с^gx\�<��u,���z� jg` ��(h���h�(�*qwa�e3�^ִ5j-���߬�� �9f��la[�xo�̄b��7v��&f���y%�}a��aebam5t�a~��>��& �5�x3���}�qfk,�y5�eòucw��s�p�po�kc����kcƀ;��â8(%v�`%k(/q��ʅ���tcyk,n���e����lԓ�k�yܮq'֚|�^�xg��vaqy� x� a.����(a�����{��l�d�[���g�m�:��]�85��c�?v��v���� %��p n;`ŀ�1��1��k��a����s�)w<���x ���u�cx?p�y��p� ���7`%?��z �3���̀�3��=o�|g�4�4�/���t�>cxd3a� xl���g��f?���5�.0����:ƀ����b�>�����u����x�6��� ��|�~��%�\sa~ ��uf�~ta.a?*�q����ǀu�,����<��3���(k���@�k����3 ?����ü�~�qa匇"�>sa.a�\�-�b�1& ���gh��jh�y�{m�c%3`${,#���0o��!m�=��2$����� =a�2/=��ӳo��y�5ƈ��q��e�i��6�4�f��nc�-��r<����0�t�y�>�[33h�p�x2�; ʆu(����<6c���{�'"�}�[6�k,��y�“.��@_�� ̱ o��i� ����|ֽzi���k�����k�y�a�ypp"xo�:�e��x�x(������?�� 8��,��a�a�:��}��e��*��l��z�:x��u��e��x�gͮ�� .apg�aσ�`*x�� o/�"6��2k� >�6̙�m�=kwzp�i �7e�n��q#j�l��1���� ���8\��|�n�z��m��1g��&���������tsum�]�;�� �z�\���.g�'��e��vv^�v����>l�l��^�����?������ҏ�����5s��8�|�c�5-�s�(�uq�n�op� p��j�,��u�����zb�(��7@�7��\��=w5ح�v v�n�vs�f�쪿gв�h#r���m�k���v]���o�ɽ�̽uzu����>eua�>5�bm�݅�x�my��i_t(߳�&?�ut�����ȭ������5���a*�s����ҫf�m��4"j��e@):��v�6�w��� �k��:�������,��=�����ǿ��t ���m�r�0�v�?y}��h2e)��`;bq�m!�pι�b�k�*su�����=�lr�ʙ'~1v镭{t�e��un#n����0j��m�](gp�5�� k|3�f��󠟸�w��yf���̮��{�9�v�c�͵ή΂�v��d�����od�w��|ߥ�v=�l��#�oj_���s�_%�@q%:l7�sl�)m��%�tj�^-����mh�c�����a�`a�ds%�j��z�v�k�z4�����cz5ڶ~a.�`j�^����p�pyo�/g"6����s����4{���]g,�ճ�f�a� �k&����t�ki������_\�y�׹wҩ�t��d۷�@l�7���1�q0� � ��e"d6����׿�'��s6*v��olt�r���w�kle�*���7���t�xz?w�1gee �y�<�y{^���x�`n����m�t쳏~��u��{�kuw�w �z|ȶ�������ҽ��� �! n4�y�"m�����l�$s#� �l�tɵ���#���n�ѫ����y�;#��ӳ��=��؋�1�]q&4k��s�}�x��1�]u�� �vw._q��s�{q:�����1�y�w��ˮw��)!?�)q�v�c6z�d��hq-j�em���5ѣ&f�ɉ:�'�)$v����]��'n�|4y�q:���:,�„f-��g/[q*&��!n�k����y\����rq&4km�����/��83����32�i��_9s\ �d��˦~۽�e�d��p��x�2"(fe��j��j¬ʊ�x( eş�uwlp%��]yi��qqn���|�� �z씽�c�� >n�k;ύ��>n�dg�9�ь�>ǐr���8s��a���;-�� n�dw�ɘь'���s���ڔ��k�s�~�-��l6ym$�$�$�*q�jԤ5�dmdgoɖ�����p���^w�t����v��}�emw��mp�8��͝�^�m���`���5�c��5��׏��5�d��\�tl0����譏�m ɖ�>�qj��lp��뒯���7y.sqf&�z\ܶ���t��5�>ss`mqq���}���0rڔ v�c�p�,�"{�ȟde�$(�4p�j�$�@9�= �( { �{ | �| '�\�����sv��������u<ŧ�ɡ��lgs2����m�p߮�_i���l07��`j���gۯsu<�%�������- /���|l06���� )�n���z�5�e�`n rn�o�����a{l(�3rb�w�<���~�oo�򙞒m��*[���(i2q�e��������k(i�p�1���o��17w%w�����kg �ʄ���}��};zd ���еq��4l�8���x��)ɔď�ˤ�:�qt�5�j����,m1u�f_�i�xl�@ɠ`rv��}3�}�5�j���0)��o� �/�ie<%&�is���� ��ʀf��es�ؿ��d��&="���\e�$-�${������ j2/�9 �u�i�$�jb%�̕%�u �|�_�ڮlj���ѕq~�4습;w|�ͨ��4��$��s��<��ў��'���,��ҳ���;���\��y>�s4��������1-���d8->i%4m�wv��q�57%�ǝ6%��td�lv#i� i� i� i� i� i� i� -�e�$�jr% ���^���ҽ�s�kƶj�*� ]gdb��:p�������l07e<)$����v�h ʃ��8v��c�n�ɠb�\�d��;n����sc�]� iiؓ���}뗷������!=�hl�,=�]a�]a�]a�]a�]a�]a�]af�ňtip�$�j\%ә�l�r�ʒ�g�@�[�op�8��~~�3��8-̍@�d���'.s�x�h���|lh�c���m{�\k���3}���<��w^��}"����r ��􉟴#����)�mc��<��~��֑3�#m� �{rp���6ga��ǔv0v�mj�^�6 �- �y xy�m@\a`3т/�lc~��;$a_��/iؗ$�k�% ���}q�m.z}gz��a��#�j���ˉ/��;}�]�?awy�3�磼�ol8��e�n"�]#��s��������ƌ�w�c����c����s�r,�o]-�[yf�u���r�7�x<_h�_��%��%���_c�z;'�-(�%]c@ֶ=ڈ�/��sj��6��@���z�fwr�-�)��zm<�a��i�n�j�?�g�_/?���&e�� ���-�&!g�r v�$�--����x���k�����s_-/=�;so�r͑�����<�>r<� ����~k���r��~��gzcqqj0v^zb�����8��8��x�w��s��:5 ]v��jd��p��p�� ��=mr�j� �m���!kc�j��w�a����or8^q���rzb�zw���~��\���;������s۴�p�6<�b\���@pw�r�q�uw�[�"�e�<3��|_2�o�m���q�-k gn��n���/y��xz�7ħ����lm�#�ck������;��htt$f�%f�e�b��e�i7f�}}�d�2 ������蒵���#ђ�!lh���>_,t��}a�mes��b���s�$>��[���d�� �d5�4sj�l�����1��|��x�2���)d9�tn!�s(�{un�:���)�7y�py�py�py�py�py�py�py�p���ѝ����!#�e-�e-�e-�e-��z��z��z��z��z^�ղ�e͵�~��~��~��~��~��~���k ���#/�z��y�#�s}k]��9��s7�z��}��i��u� ��rjs���i��߸����k�����'�����_y��w���޶�x�� �d_[��g ?|�)9����]�.�)�]pp�ev�ͳ�š���eo-�2-�2-�2-/z�v�� @o7�:v���.;�|�x�=�v����`z��l���u�����g��" ��t�r��u����&���������w���v�u������o��3z�}k]��m2pz6�z�|��c3l�/_�� b�c9 .�:�x���w�?w�c�ztu,w�g���%�&t�`��ep��[0.�mso9���-٫�h�`�'�t�n$��[c�vg0v �]���b�`c�i���������?�yt�>j�����x�bpz9��]w?����q��i�[�a��˭�*//�jy!ukdrkdrkdrkdrkdrkdrkd���\�\i�z�c�c5s�1��c􉳂�em�u����d��y���ruv)�u��rev)�u��j�ry�py�py�py�py�py��y��y��y��y��y��y��y��y��y��y�pe8t��uf�c�y�pe@t��ufad�yqeht�����������������������c 塄�pby(�<�pj(%���c �d�d�d�d�d�d�d�d�d�d�����������fi�ԓ���ɻ�f^�067�ڂ��m#��f7��c$�n$g�h���\9#�fn�1r��t<#?�a� #g>i�2��e$�h"��3���`$��h ���# bf�|0r����#/zy��h2������m�eo����$mi�0�>���,/z9e�� %f��4򞦑�4���i$�f$�f$�f$�f$�f$�f$�f$�f$�f$�f$�f$�f$�f$�f$�f$�f$�f$�f$�f$�f�*s�?pݽ�o&�f��u�b��:鱡y��gi �`���s�����k�\p���n[��ݺ&�mox�l|g��[n^ i i i i i� !)so�|4.{���ݛ�[�!�����8����h{g����&��֊i���qh�b��jt�c�q@5����8�o��w����]q� nuʼn�8�'��w����[qr nmʼn�8�o��c�a�� qv��5� �79�m h���wkd ��t���q��3�v�v��i>=������ם47aky˼-i�x�n�ojܪ7׳u����2�o�h��.!tg��$��/?>лmزw��o��j��7-jbt�~8���o�����˚~�f]hel��f���tj����<��*���b� r÷�[ �x �x �x9�ԏ�ez���*,��yq� ϋ���υu�r9�|n�����r*�e��y�lv)�u��*�� � �� ��ea���ayؠ,lp6( �� ��eacgacgacgacgacgacgacgacgacgacga�da�da�da�da����ū#_em�����eeo�ʞ��=- {zv����iy�ӳ��eeo�ʞ��=- {zv����iy�ӳ��eeo�ʞ��=- {zv����iy�ӳ��eeo�ʞ��=- {zv����iy�ӳ��eeo�ʞ��=- {zv����^*z�e��p����.j�<���g-�=�6#�^�4&z��p['�ԣ�����7�s=������#?�����^1��ū~�> �|�u�?y�s endstream endobj 554 0 obj <> stream x��]k�]wym�����vt�����9����4���ܱg�˓�=��q�ǥ�x��ԅ0%dy8�hr ��"��cu� ~��hu$� �>(}��h(� j�~�ܵ��w_z���{ϸ�k}kg��q�tu圫����ji/�pi��� ��be�;�bek-�ty'�y1u�?��b�u���m�n> �� ��*��q_���}�ji� u�j'7u)u˝���t낑�)�7x�7�j���n��7k?l�ͩr���r�rin����,_ ���(����q�c��9�oq���͂�����gk5�[f$�wcl��pd�� $#m�21 ���(��@|/#�|�=�j!�j�#fu>m t�ql ݁8�d����p%|� 5�ȁ �z�y�(i�� � �p%h?t�)�� �&�'��x/xh� ��j��œhi�jz���d c��9l�0�a�,���t��z� 5�$��g�jш#���:dr��:dz*ȁri�u$�rڣ4<"�ci��c��ebif'��i��a$z!c��r ��j��v[ �c `�:����6�f��@�w��#ȕ ��q���$3,�hb� -9�a����� !�wa ��zg��ebi8d e�1[�rzbep�zx�a n�p$58�]ux �������8$�2?���(ԅ,) u$̹��x<�\���̹xx���x� ja���r�qk��5b���*��5^j��ˬ�x�qo�gayrj��/%k�| ���mx�5*ae6h���,�@�q�r�p\�[r����" [i�(��fd��oq?�ţ$�-�$b7��_ �#�%�<^ȅ���5��f�~�����x鴅�jidlj ���;»#���i��ŷ<��v*�%jhq@i� ���)»c�xw�r@ͥ�ը<����_"�;ղ��i$��*jt��<���ԑ�� �z% ��������c�!�w'�5";%��eud�.�; ��$щki�,!r��(#�1��t�5c(%��(�,�vī#�n�� 1j� ��|ki����ơm2�r��[y��a�e,��(���f��vk��gv4�0v���.�0s�pol�@i� ��yԑ��n-��jia�<¦u��z�f�t��� d���g?�òc������~��?���w�ο�s��v�w���3ߟ�ۥk�ޔ5�ox z`�m�{nqznqznqznqznq�`�`�։}�f��a�m�vae��qt�!;�e�� \�h~�gm��g��h���z��z~x i��{�켜��&�}*� c]x�lq�1�:�e���������#�wsr ���c���'�:�s�8z���o�s�'�i��6�\�&���:o=��&w�ݻn�w��޳�����w>a������u��t[ȋ�������o�r�����[�(��<�\�i.�4�g��3����lsy��<�\�ѭgt���lsyf�i.��z���a�׾x��n����n�f�¨vc�e�y���/!�:��]�m�.j �f?��?�g��{��^=? ���2n�e�p5��l<����§��^�w���g��ly���2ne����љe`�_��/����_\� ;���=�x����/�|�߻�:4z�$��4���m��z��ogz��k��cb�4�;j�m�����j��jm\��/� ev��*�xٺ�jy�" sde����a��a��a��a��ኸኸኸኸኸኸኸኸኸኸዸዸዸዸዸዸዸዸዸዸ����������������������������������g������5��s�����o���?� <�x�)��s�����o�矂&st��{�&svao�g� <8 �� �\f�3ׁ����u`�:0s���\f�s����`�ǔb����� l�g�ӳo0f=�\nj� �7����m� `˶����;��'���� ��s�g��e���jݯ�����z`r-0��\ l����=�|�������2e��_x?��p%m-9���9c�3�9 �ws�fe޴��b�� �-vy���m�o�a[��\��m`w��o���8����[�m���;�3��3��vs[��%l�lk3]��v��u�b���tx��sr�}x dž��f�mw�s?�nc5lsxsz���.j���ȉ#߽����o���ٯ5[�7���7���[�'hasnw�u��qc�e�aݙ�n_�>�x����鞵ηv?�:��dc�sqk�3�-�g�n���g�x#`˺xҷɝ��ߜ�|�]''��p�bm���#/�}^� ?*��3�o���-�d����{_x� }�j6gr���l�ea����|i����� �8��s@��]`�w��ݗ}��������n> �&w�����`e��(\n\k@8��?�{#��`��lek����9��? ����o�|��}g?yϛ�q-��uy)��ğ�������~��>���?���[>d �z��w>���n�k_�y������m������ɯbm�_�i��j��ai� ��9�{g�/���>͛9{wǫ�5�y�=le�=e& "��i�ȥad� 2i�4�ld& "��i�ȥad� 2i�4�ld& "��i�ȥad� 2i�4�ld& "��i�ȥa4���6y�yp[��ncu�cx� ����z|to��*�`�(��}aa �ei��;{͜�a�{ o�yzߎ��_���}wm�æ 9�����^��b�z�md�m�3�g�d|�1��lz�pchϻ\���$d�[l��ݗy����k1�"؛���j_5zv��o����{��1�cĸe��형;d�nun��vđ&t��f� ���l�ٿ:uy睋� <���cxq�f�^���]��n�z}�ҳӟ^[�޷齄`z:}�c�u^:��}�._v���lza����� �e��sx �'l����v�������=f���7z �b���m�������b��x�dr[���q�u&�i���u;��w9���-x�cl���:x�qn�p��"��4�9.��p͵�̊om�����ìm~amsa���.��}h�sa���t�d����������������ʑ�m�z[eht�x�m�-�&7�{���#ctc��*�~�`[y�nu�����?0�� wm�v�v�>�=x[�x� �\��ؑ;�ugd ������� ����w�~p Ϳ��?���rx꺕��g�m�''u���q������������������f��q[w��^=r���g������]��s�� &�~�j�0 j���(��4������g���罩��`oz��b����,���w��;��x~�e�_��c��|�w��2�.t�� ܻ�]��%?�=ɯ�£;<�ã;��i��qh�gxu�j^ �`nk nk�dq�zq�zq�zq�zq�zq�zq�zq�zq�zq�zq�zq�zq�zq�zq�zq�zq���w%w�w�w�w�w��� >�(iwe���3rf�3��qt e�(�g�?�r�e&)��"�9�h*ev)�j�w������������v���lt���� ����td�"=��hp�w'(2u���\u$�"[ur����ud�"e��)rw����u��|hդ�&�5i�icmk�x3 ������hfe4y��kͬ�&�5�������h�]��|��&�5y��sm�k�\��<��f6f��|��&�5y��sm�k�\��<��&�5��5���wm�k�]��:�/y��sm�k�\��<�\l5���wm�k�]��<��&�5y��sm�k�\sz5���wm�k�]��|��&�5y�3�3(ú���&�5y��cmk�x��&�~c�ws��>�ԑ��<5�! �h�cc�ϐ��3�!� �n�3c�y?yfȯ��|26gi��f;>>`56$�!i ibhc��đ$�$1$��!eѐ,�d1$�!y �bhc��ő,�d1$���ð��0$���<���ww���ț��9 ���9l�v�/:��sx��%�-e�r�-��r�-���y,���y,��r�-io)�"o�t�ne)��e�\�a���[:���y:���y:���[����[c<:��z���3z:���[:���[���o79 ��z:��qq�)���o�x����[����[���_[���_[���_��ӯ��a:��ז~m�ז~m�ז~m�ז~m�ז~m��6��� @;���_[���_[����������6�l��8 e�qe�qwnw������u~�#e�qe�qe�qe�qe����h<���8���8���8���8��3�i�xgpgpg��(�"�(�"�(c�i�w���o����q��jbկv�����7���y�wr��f�k��}�������jp� ��}� o8�����i1����s� 6$�i]ٹ���_9�k&:�;�yϟ�c6�c,ۜ�؜㿐s-��9�x!��y��2m� endstream endobj 897 0 obj <> endobj 898 0 obj <> stream x���ˎ7���z�z�,j�i�� ��\0�yy*��%a�~�a�_��'d %�� ��`0"2_����?|}z�?_>������o>�����߾�{~����_����û�/h������w���~����/���ӫ�{z��{�ׯ_~�k}�����x����������o�����?����?�y����x�������b��������鵦����{����������o�~~��a�}z�������������黵�޼z���2n���o���6�~��p�a����~-ud-��$��������3d��l�� ';�iԦ>,ꮋ��:��t�ϭ�p�?3�f5���лua���ɏ�a�t��{/2�5�gpupup ̳� pz(��[s�x%hdz�h.4��^[h�0^�b9� �ܳom�j����^�7̙�xt#t�=��� ˣ���~`ӊm>p�5j�ػa�1�xah���:�zti�6"����`��t ֜����qv�!x�x����}�l��' /�k�/~�˅_�����nn��9ƒ4\ ��!k��0���� e��.���e~e�7�ӫ�~c��a�)��ni8�$u8�:��� �� %gy��.q-�.�r:��;p��=k�\p? ���p$�1�j�{��ep��л*z���[���rmp��x�j�ln -2z4��ژ4�vܳ�v�'�6��>\�o6.����0�o�v����0��ywh�g�5p�vd��/���g�(�,� �9ȁi����eih��� �wg��`9���n6b�κ��ޗ�o)1 ԋ�y��@����5j��ܦs�'ry���]�� ��=w���x��l�5z�,�!��ܐ��x��;�ta��r�lr҂z>:�q�q�0y2 t�@u�6�emli�2��p�[�4���,(;��5�֬������[u��ҍx{ g�qƪ�}���sbw 序lu��~d���vw��j�ˠ��z�"juʒ�#j�f��eeo���p%�v���-�sp=�fd :����#h9վ���_�� �f�nb�li�[�>��6]�!p�7|&�3]yp�$�y"��c�ġu���a,ȃh� ���˃#9��!�e�k~�d@\쉋}pb'tpz�g.�b��ҽ��j9�)��xȅ�i �i��%�%�t�ņp� i�h�dp�� ̳�#����ppp����";(d��/��xp�k�f;�4�!m�pb]�����dqh�ep*�עep���� �=[��%ppupr>ڙȟ���26ashh�v�z"k� ���tg?��]��k�2f�j����o����mi6�t���xo?��h �b�f�3�� ������2�jڥ������1��j���� l�$3��m6!�vx �c�&8;m�b���m�6y�l���7��=qs*jo3����> 7�"l��g���v&�>�hݳpd?���f�����:2���pg�hc�t��4a]�����ȃ,h��t|���p�j�i�g��h�$�w��al]��dm2�hfo='{�d۠u�c��oq�~������ �q���%u��*�h���t&���f�}���o��p��y�o�j~-�r"y�i�)kr��ҽp��j�қe]�do��mv�l���m�n�mge��kt@k{.ў�u�k�]m���iq��6��}����m�cr�b�:6)x�br���em�1"@s����}۔f��4��*yb�,�f,���lq]l;�#)�#c��f�@zs�t!k����f$���z��:%�ж�(q٩�&%%6v���n�:�rڔ���)�m�dl�z��r� ��k7m*�i-]�dh� ��k]�t�؝7-���t�?�!����l@v*���'��7�����vjz� z��g����tư2�;�lz�-�r�/u��ܡ�=u��up1/1�i���b�o�t�9t$�(� �bj�rsz�������<(�$�q-��j)gp�&�wvo�r��pwqb��� v�z����d�m�8 ��se��*���el������l�n�hp8ޚ'�)���xɦ[��c�hi��=h�j]�[ �b��(�(�2�y�y)gp�o��ԡwavz��]ȳ� �@������ .*iχ�.9�pu�<&z� c�7�أp�,qif>�f������0�7�.)yȇ��6�q�ty/�� ��{6���i�����³�r�l�껢�.[�u�� �v�qw��e�&�e�(���٫���8q�� �ȯ)�a���n�ԭ�kwrdw���u�����9�岛�jr�u�bc� �n���̉��jr�u��b�3�d4g%�;��kq$��b�šk�l��[�tsѥ��y�����n����e��}�fp��^w�keo�:��yn��՟��c�����u�&ӗ.fȧ>�k��e��./;�a�����-�m��fta4��6�ċ���[�^���vif�j3�u���`ު��]��wj`�0�]]���![�h�k޵�> stream x�̝[�fǖ׿���|��������v����s�s��83i�$dl2$&�i$�'cb2�b\$ ��hh���e4\$�������po@b�ׇ��%���g�����n;�@k�{��uk�z�z���w&e2��m��o���?��ߛ��{&�/��dr���o?��o����6���i��/�����'��9)���d2}���z�|��{����;'�{��ͽ��w^����&対�i���˿����d6����<�����������?������{>�����߼������y���6�l>w�y������^y�ۯ��������o�w���7�������y������'巿����~��g�_���޴?���_�������o���om&_x�����e2�������o~�� ����n��ӛ��� ���>�����w|������#sr����5������/|������{o�׊��{�������������כ��>�gr�a���o|r�l��������z_�y�g&���oo�ܼ\�xs����&w&��듊m��7=>��vٙ�[����_�a�������?4yar���cä�����&�rbr~d��?*�n����6eosܔ�7��w}�m���4�>��)�mye�*��ѧ�g6�mq���o�)�l�}qesv7e'���j�݉6�da�4��}�f�j۷n�a�?�~�v��uи�r�_۔��q���wcӏ���u��m�{��n#�����m��my`sݔ?�)o�ok��(�|��v�k����������r����a����myas޷)���6�ݛ��ָ����:�wn�s�\�<�)oٔ�q��m�����m�|��l�g7�m�k���m�ئ|<��t��}_ܔ�d�����y>�?���<�ܷ��o z��q��v�[e�eе�b�ϗ��.�}����}�n|us�t����eл�c�/ę� <{a�q�gp*�ǘ� ������x_碗��d���l��nvy=2~r~:h�tt]�#�n��j��@���t�e��[q�����'��'�76����2��l�ݔ��}a��أu���/�]�cdy&�\u�o�;>��r'�xk�ʤƥ�v���}�d�ܙ?q�����\i������ѹ-�r���^q����,���7c�5���m��rg�����v��z��h�ub�៎���]|*j�ه����3�-��>����_*������k��r��tmfk`�mwc���� �k�ɰ�7։��y����$։��nܯc=�*z ��x���q�r%�gїe8w1֣x���u�q�����]�l@�r ���y���2�q��e=/bv{!�y�� ��~�>��u���`�k��u�2�v?��q�t�ȃ�wvxqw�wm�j����p�1 �)=�h�>�k0q׃�ʰ>�1��m����c�~�wq��j����|^�y���ϣ���1.��ީ�p��4��@��g�����qw��<we,ց��e�!���t��g�ǘ�s�� �)~��yz}�qߡ������np�o�tv%���gʠ'��'�:�v�k!|���͓����x����u�}�&>o��ǫ�2�'a��[��~fu�>oq�6� �2��$m_6��_�w�o�>��w<q��ez\gs�^����_�1] �c�:�^��tsބo���s�c!n���r���)�� f�'8�޻������f�)�����=e������}y�h꼸��m����gv�r��y淜_-�� wf����k xn���i�8ȼi���{���8��|�e�ڢa4grp���,m�8f�{��m�tf��ndz:k�i� �a�{}�d�k�w������/׍��h �(?(c�x\���j��z�pݣ<��g���xǘ��_���_���3�]�h��e���1>� }bl񷮩�ׯk��q�1܄l�㙹�j����:�ʰf���jq��/��c^z;-o�ι]uߕ!w��{���2�!\f�q���n�b��wc�n��xf��f��h>���xw�k�u�} drx��!��5f]��2��豋������?�xw���d�{�[�q?&� \��=��9�����ή��<��;���2��j��wu��v���k΃�ր=��!������n[���� �w��ۻ�u�e[�|�,c�/ ��n�w�w�g����'�o>@�u��^ob^�i�}�6p�#�op��>�1���l��i��e�ub�5�p| �c��s��w���v˻qwmn��n�z<:f]�ig��y���a���>d�^�!dp���f?�(gf{��k���j �1��8q|b��}p�_~;����η���v��?s���k����c*���2�d��4�w�wz$����9._��e��|�j�yf�a���k<� v��k �ݙ��\�a��ws�s=�7��a��x�8a����b܄e�z��}�:ơ=��w62���v��,� plv5�v=r, p�{r���>�v��/��ɟզ5�;�r�<�e�^с�p�:����1�t˖#��3��$ڈ��'�'��8���$���!?o{`�/�1-�o��˷��0x�����wt�o-�ʠ �o{x^��|!���2�o�i��<-�/�_u~\|s�^�d(_*~���u��u�}�`����c�p�f[�ds�d���}��h�.c<�3{�-z�xp�w��}�w�g�s������d�ӛo���o�^�=h>�.�p?p��>�!�,�c��x&���y�{p�;ᓏҽ�#:e� ��c��q�o|:@�����o���t��m�?xg��xɾ�ex#j~9f_�li�doz��� z�>���1j��� e�z? �r�:�}�~�l�t)��=��$|�f���s��%`j��w��nd���4nٯ�}�t�m���i��׳2�/��$��2�>� �h�h�u}>@��2�=��~8�w��pnd�:�3�s)���|h��ӏ�~�3�~�w�����c�� |._�d^�>m{���f�ttr��`,�>�qp_�~tt�����4_���8_s�e"�׺���u��\����fs,ql}�4?*���k?,���}��;���=�z� �<gm[�b����u��y����`�u�?���_���l��2����z�9��e8s,�7�����:�i�wςy}�'ek�kvw#dp|��)��3s$z i��<���i��383kǵ����y���;��-;�ܖ�1_��l��90�)�\���̶��mi�d�����z��3�� �!�ٞ�ǔ�y��i��j �97��ueu�e�1z>t�3]c��2���qz��0��b��"�v�������*c����>�t}p[�n2o����xc��]��ߵ�:��hz���p����x��ʽ*f/�o��]�܎�c�����v�y�{t]��n�|��y.p�yfl��o������x.��eay/�x���u���m�ߡ��8���3g%;x��td0�s��s����ý��5�8n�>��׽�i?��f�oً.泙�e=�ؙߤ>2�o���v���~h:a�9 �m� �ѹ�fs��ý���k�̍��f��}���%�oe}�el/�k���ib�c�l*�;�c8����5���[�)�7�<���k�c���s��\�y\a���t�t:<����e���nnς)��x�dzm���wsd:o�d���ո|-�y�l�!{�����x��(�yfc�v���'����}� ~6���c���z~j堌���q��c��v�2�9٘��t�ɣ�i��}��/{��l��d�_r� ?�0����npx.���s��7�� ���g^�c%�>���bz|ϊuտ�o6-c�d�j����)��q\�,9ԏq?�� �������'j���1�=t�g�^���� j�|�i�(s��[w��|0�>r�iq��ah��\�r�#��j? ˽ �!(&�~ ��ēc��=cl��)�*����^�^�ư=ƪ��y���e�-ʙvwz�r^^0� z��m��$u��,i�y�k�v6�k�w�u;�\"mr�g���e1 m��n6'y��p� � k�.c�����j��������2�� �c�������\�`���o�aέ�j.�a��4$��_�>� 80����ou �t��-�h� ����o�o� ��{l��`^��2���m��y��}�?.c^q^9d�q }:ct�o�2畳2�ƶ2���.��d�l�g��>?z�����׌n�䪝ݎ���a=�����s���2�ɍ5xd>c�u��}ů�2�;��?�{��&�k�8)�~�l~�>ҩ%�3v�<,�r�&v�l��2wʽu�ɩ����ȉ��ou/�c�ga.zp�ˬ�=���?��am�9�qh�;�.zǘl�j�(��e��\���lܷa��x��7|��1.q7g �23<{��k9���m�w���.cڹ)^1�/a����:{7o��_����m��;�7���m�g����v�)�g�9y��s��˦��s�`<�u���w���� 6u�z�q� ��|���q�~w�j�ڡ?������rq̾>�y̬�ךz_� ǵ@�%\�-p�6��'x ܓ?l/���i��c��i���6����v�n��ǹ�k�%�]�i��/ពao���k��u�1-e��^)�j{��-،u����.p�� ���?�)w���.���s\s�� �pyn��b���sкbct�e~j8����q�jۓ�{�x������3ӛ��wcx����@��h��qow�_1�t�8}op�� q��#߮:� ʑy��5�x�t�k^�-[�2ċ��k��{%�%�j���m(� j�3��g=��/w�n:j�ul}�w~�c4ӎ\f�ex��ǫpo(��2�luv&?��~*s����.��� |��l��]�)�ɓ�in�%�o�^�`hg���p?��f����'����-�.�w�e�si#�[|�kفl\0���e�wu.�kχel���kvї:鱊��lqo>좏���1�9���2���/�t��%7����l��x���og���g`컴~�9ד�/�c���ˌ� �7��o{�y�ǜ��g�اj�µ��!���%z[���ŵ_�s�5��\�ϭ#.���g�����ݗo���:��}gꐏ������ ��k� fl��8]�������z��h��a��(���5�搅᧜3�%��s�2��l]���/�u��/�3/>gϭ�����c�u;�y[�ߌ���kbz\�w��n[��y_ct 98��ox�񶮭��6?�?y��2��?�}�}ɠ̷�w�����mk�[�[���6�p���g���[2�rd�?����2�p7r�f/�1p\/���~jw��r���{���_r���w�ڒ1��ff�nk�w�?{ˇv ��|�yoem[���x$m���8no2=�z_��'�c��]�n���o��x�����޻]0f���s/��qs��tn��?��}(�� ��y�����#i���<�vl�~m�$�qog� �45.ϱow�q4�-�2�te�ݩ>�7ɋ���>�rߢ{�q��e⺪qҷ�؁k]�;����rmq�u'���m��ܓц�>s�wg�6�/����<�<��r�s߶?4�����s�%<^��e-ע��2��7)� �>\-���#\��,�h> �t�}�y��7���@��\���y�ԯ�x߱�<��`�)]<��4ӯr��ym"�x��,�8������|��,�`���g��<仙�wo�}no�y�d����_q�"�=�)��#8�za�y����y��l�;��qs�<6'] {��=v�u�h;<_#d<&������u���x]�s>�u�ccʨ/c9;�>�'��}u'��9�x8���c��m��qf���<_��(�,6����s뜗�e��>�:n���~�a����)��8f1zo�}��0}�v��en���ux[~͋� �'r?{����aq�3_��3z��ox��nr�|�e.���3x��fn1���s���kv����rdߥ��^��2�nam���$(�l�<[����g���n��������*����ْe_ڼs���i&g�=5�>�l6����fc�:�3-��i�d����|^w�z��*gq�su�=k�2��k������)�fy_�o��� �ܴ��'�;y:�z�'z4/-0f��}�\��fvt���{\#్?{,��=>t�[�qk.!�m� ����<���ҽ�up?z���6�v��� [sd�x�q�q�\�u�����#[��b�w���r�{ç��c`��8����������⸫�n�x.s���м �l���xya|�:�#��ї��/�����o`�r0}/ri�v%����7�:w�j��;�c8|&��is�rߔ���o�u�p0'![gn�|�=��e�3�����2�>,�\�s��-��\�ԏ9 �_������2��{<3�b����<�x}�,z�-їr�~�%�l>s�*��9[^�p�(_��:���<���ntϱp�p�w�_�]v@�r~�n��?8�s�� ���h�].���p�]��o4����x�s��3aч��i��6�s��y; c�e�<�c�$�p��ô������:�v�v�.�����"�w� �`���\�2�'��n�c#���g�]�q_�����9m�h� �"�& �ݖ�}�7w��: ��pi� �h6�k��sk�k�������s���q��x�c�1�z��n�-���/��jy�7ow�kd�o� ��*svss��x���)cےo�lw��4�o�k>o0�w;����օ2֍�s����f~c ��� �&q�4ߵ�[��pf����f������.��)3�[<��rky �q���w��� �p�ca_c�|�`l�ŵ��{�/}�ug>�1��.��{�ǿ�����zt����2�bk�m5_p��/��nt�,s�;el���)�l�ߪ��z�\��״ 9�r�����n3��)���y/މ�3��9�h?�����>}�.� k���)��@�d�=�]��zֿm���2�� �o�� �g�-�ѡ=��2�m�g9q��rߥlγ̳�v�&��>uop\��2�5dnj��{��������z6_�w��g#�h7m�slko�1�|ҥ��l� :�< �e}�w�e,z��)��:~7?� �{�'(w�co�u~[�8nўůzk2n�q�z��5�����t�<���xf�c�'�]����e~��m�sƭ���w�{� ~��>��u_(c��^��gtv�g��[��]'��wh��1���e� �i4g,���,�!>���t2&�v������엋2& k�����1v�"�g�m����dzk�2�{�v�ܬ?n`pm澗� �)[_�er�y�t�o�f}�91�u٘� ��7po����ɒ|�9�c�,[��p�s��y|�y����snk>�[����4r���6y��!�*\i��wu��g��u ���h��� �=u�ׇ�;�i�3�_���������g�:q�%�qemt��o�~�������7� �a(?�u-���q� ���� .y�']�����2����� ��.�d:��ôϖ/q��&>?��92�a����0�d��z���c�9-�q���qn�4e<����p|~�5��evb�vy:���;�:��ԏ�ꬌ�jߡ���6��]kz����5�te��5�=b[���:�@��{�^���we|v�y? �of��;ڥ�(��ϗ�>}�x��r�#=z�ߥי��2|�zmt��j�q�y��1;ޓ2���⡾�t�߳8�a�~#x�]*]�l����7��[�m1�\|s?}�o�5}�}���]c���hѹ^�({^�(��{:� ���|>o�dv�'0[��m[v��oc�/�v�����^��k{�y3�ڊ��'��8o�<��7y 9c{�'�|��0gi����5<�d���>���89kk��m����}i���d:�:���{����7�֟.����>s���_� ������rfq�}����~�@>ruv��c����*ȿ^ �w��� �ms�|��:i����׻l����xw���ݳ8zfu�c� ����� $?�k������3�o�; ~vq�rt���q�y#`��a�8@[�=k��ڞ�a~�{5�o��ՠ[f7e\ �әc���z'����h�߮u�{�����>�1��`)� �k�t�'(�u�"�9n�邫��>��w)�n�c���ڟr8�i��)6p��s`�;��>nǫ� ���ឿ������&���p�c�8��a�s.�3x�)����������>��o2*�v�=���o����,�����s�p_����r=�wy61��ڑ����������~��@���)i����ќ���]��进�������k���tg����y�\�3����x��(���y�}��z@8s�.u* ׁ��m�ݒ瞲o���nn��f���a[�������{���^��w�v��3i����[���f|�2*�py�f�?(9��8z�{�^/і����~\�,��{����5 }�^z4 �����!ܺ�w:|�py�y�g�m�����{���qh���n�o��:g���`����� ��`o���ce�a�!2__��̭ �q>p=m�5������[mz�ۖ/x7�d�z� t&�sk]o�oa��d�5u{���:���3��� ��v�@��%ϋ���n[w�d����nn�t�����<�������"\��gy~u�h��h��g\s�<�?�l���n�y<ʜ��� �^��s���w�ϱ���yb�ʒc�=��_�1����w:;֏��]��s��u���} c���<��ќ��/ʏ2��q\lӕ\/v��߶�e̛z�і��}z�^��i_rx�c�������`-�=��o\��e��}w���v�o�46���phr��w�e��� g���y�k�ki�k|m���� ����l��u�2�ų _ -�x]�=������.�mwr^x,�u�!��w4q\��=�t�y�x~�(�;�e\�5��˞9��̬ǔ\?�~���{�[|�s��ƙ�p���b��7�/)�<�\���g����9 x'�澯�w����ce8w���u�{p?~��|d��q��/h��civ�6���v�/�����w߹q�r��`i�9e���{����g����.��c�tm�p���ơq��j=�@����?����cw�����}���ͼ����<�t�׭\��nl�qp f���s�`z�z��3n��2�e?���?�>�j�u�{��c��.��_|}�~s�k�������>��ƌ�\�x�{�{vs�2oi}z���� i���&��e8��c/���ڭ �u3s�-c\�ɋ4/ c@_���i�pdk � _�s>q8o�]6~�>1^o��/�pl ��x���=}��p��e<��i/��ћ�x�]v>od�l�/\�s���(�;��c���7�y�q����e8?)4�� 1f�wz�������z��q�-�w<�u=�s^=������֏�7���at�f�t��<y�~��<~��1v�ujm��/�o=��&��i�vyfs�v�q\��gk��5!c ��}q���2�������օ��uҧ�{_�� �gr���o:����pf6�oڳx�/�u�d�u ��u�ǟ���e�ae��/u}�|�siś��s|��b<͵�a��?�gɇ�r�w0�c:�l��k�g³2��}�u]�̥ϯ�~�9��k� ?��_ɱp�2����e��u㟏 ��_$������6׽���2���5����5��x� �r<֡�圞��#�}�8���a�� y�՜�)߫������ }���ߴ�m�k=���_}���e���'��������[��~nx]w3�������m��v�c�����d}>l�ʬ\���q�����w�޾eu7�og�|υ�纴ey����l�8� ��>`:~ٙr����f�$�v�.��iw ��� ��}/�s����uknyz�������z��6s ���v���>�pk8m����� � �x�'��3�5���b?���?i���.�m>g}�_i�d�{|�������i��v��)xo?㺨��/}���]v<�%�yr���נ�x֋�;3z[4p ��`鮯i�sُ�t����wύ>�;��f=g�w=��wx���x�g�m���{�ݜ��ѫo�y��s��w��p<�!�������1��h� ��9�s�l�}���2w=����ﭏӟ�(3&�b���|i\� �'n��2�����x�۫n�o:�������x�8�saue��!s��=ޙ������of��� �����j����l/t����ό���̽g>�4����0�%}�tp�z�"}�k�w墭��� ok}����i/�}�#���dd�� ���9*�˻)-�z� �����ƥ�&��~����e�)�wi�fis�#��������u�d� �!ڬ��ɨ�ɹ�s0y涕٢��^ﺝ}�]��i���fw�o���2�ӳw��2z�gr���ǎ�68m��x}��k���rq���"� ��q��kɡ%�l��2^3���2���.����b���v��� �r ��q�uyy�b� ���ئ�-o��3��lo3ٻ�=g��l�-ꬎ�l��sw��,�f�|�eĩo\x�zv����뷘f��3��˖��/����o�)��֢\<[�>�c�ߺ����r�]&k���mjհ�߆t�>3x� 2���{�����?��t�|��f}k �9�7��i��6��z{�}{����/����i�l�����[���8����ٻl.�ʃg��,�5 � z8lږ���� �ڡ m2[�zx3�s�3�۵w}���ʸ/#��^��t����0��xݶ/�g�s#{��2]�f-]m�λ�c��,������[ҡ�f�t��q(e=��0��cz683���9��(�h�5w �a��i;?�g�g�{p�k�n� ����x�����ף�k�r�g[�y��lk�øb����x5�!ʌ}3y\�9=ҕ�t�/�#�ӷ���za�^��fy�l�����o>}n�o���iϋ �]ߕcu�����a�hf���y�o}��ax��v�|7u� ���2������&��1:�o!�h��ufe8�"���� }sc�oq�:�9lk �ִ k(�;�.���d��=�xg�-z��f�ig��|��ug��-�~�vڀ�w��%}:��dc�,�뷜dwzsq���d#�����2��la���5$�y��u�k̵f�<�[�ىϙmpo�����r��ο�f�o����} �k�_ g ���๯����nr�/�n�9����}vր��y��{c�;| �:��ύ����yn߇s�2�o�e<����z�����{���k��x�� ^]vęْ�#��7����k��rw˘~���ϯ���=ho��b_�q�� ���i�fe�� �q8�w�����گ��l��|��74�sם���\�����xx����oad�2�\w[����wog��]��񱎱�(]ү��qџ�x��g�۵��<ޛ%��;e� ΋��k �,�ͳ�i���f���i����^?}=u~j}�e���s�@~�=i����^�_�����?�?ǹkx9?f:�spo0���x�m_�&v�8��f��|�98�i��|>38-!��o���ߠ����6��5`g���s�3�v�űx���b���n���za��ezƿk��i,��~�����n�-�x@�9�u��s�_�m������;s��{#�������� mb�dk����~���~�d<���z��z��xo֐ �&��{hg�o��٬�ϩ3�a߾�w\��f��� gy`�׿�ܗ����:~�8b[�m �9��]�o1���p�~�����h�ֺ3�מ�����<͹�������3q>�0v���';�ؚ�d �v�j�u�������x�眬��t��'���е�omj�9����$g�۸�d����l.��|yi���ƕ�c��9�uzm7�y����ӷ�޼[� �&ޓ�ٺ�m/{�~۞�36�esg��������/�8o���>y̒���:g%��%2^��e���c#��|�dy>�9 ����ll���$�o٦׭9aa�f�}�ۤ�c�;��z{�h໖�"o]����v]vno��yq]{�0|n��*��?��cf?�����q��l�y��������>p ���ʧl�7�] w�f�ԓq6�e{j�o^.�њ�\�̋�����b�wq�����ȗ~����qk������ǒ�nx��o��y�8ٖk���q͓��qr}^��z���)���v\������3:�lz8�nt)?�{|�3�����o�9o���<�yj��8( kx� "���0*�t��}�~us�o����[u�y���|��ω�����(z����[�z��r0^�����m�h��c �ͣ���h��t��zeyc*��z�g[� �scdcr0x�~Ԧ8�w�p�������]�<��k��>*�����a��}��!u�p��*�i�߂�6�ݰ��u�4���&���\e}�qy݀g!��;�k�ΰ� �ߧ��|�~w`@���n���r���5ծ�{?�sc��f!�������c�����i7��y�&�s�ݽ���&��8b���gg-��(�;���i�n<��� ���y�1��q�гg���/� ���s��w�n���{"�~ h)�0�6Ϳ?�@�� eh�)Ϳǿ������y�i~v=a��*�p���7��[�jw��>�qe���&y8;{k��wr������1��ytc(�ot t��9�}n\�{^��;�u�=r����}5�gd�}�#��/�� ��t{��ƥ�_������c�{��e�h ��u^b]q���-5l��`@ �?��� �m)��ʡ���f��i�n�>����6`���y���<8�~[�ǽ�"��뉥������oq��yh ~=��8��a 8f`��_\;���[����e�?��av��=�,��ύ�z�����i�e��#�)�jq_�(e���n/~8ҳq���v��g�����q���6����oe�ԫ�q/��t��hol���pzِ"m�z^�~g��a���������^{m��_l_�xo���cqܽxz):�⡥x�f}/5�g��/��;���h��^�gs��� 7���{{�g�: z�w�3�hj΍� :`���v�� .��xv�fu�b[]�ez8~f����r, �a���1 0a�ϯ-�n��bճ���z��i<�񁲰�"�^��p\d�^�f�b_��s�sc�#��� c]��#��}r�n p�?���(�oe��uڍ�<"�s���� ��yf� � ӵ���.ʊ���3���#x��z�dx#b����^�|x�_�>���q��.�*�q�p���w���߃[|�6��ㅘ ��h1y�g�y��k�~�#��#��x<#s�y�n��^���e���� �ˊ����l<���pn�� ��[& t���q���(�?���k���,�ki�|.��)��?��5�����j�s�1z���eq,�\�cq�a�]\w,e�"�^<_�r�u� �n�ݑ�r����\ l5г�w;����k�i3|�,����d)}�bu�b��ޡ�b�=�/�{�(~���s�#0�] �|��z�ӑtfq/í��nq�� \ޫ�^d��9ğ�}�o��{"x�c��;~�?��.��ql�s�gqǁ�t��0�)��^g1p�>w�,�x@ x�4h�,�/�=��ӏs�``��(�����)����]<�x}@�0 �|���� ��$�s�x/tp��wi�w��hqs�_��p��im0������_��i���h��n����ae����9�1^�w�g�`��|h �e��cⰷ��b}�;�p]c���s x�(�uox� �5��c,�|�x~8�-`���%�9/��ri��)/% �=��zx���{���(�m그ox� >c^ h���e�a'm�es�����e/z�zq>���\@^'�/��me����y��t����3�q봛�a1�o���g�~������u����0�s����s��c�io�sw�����x�1o��r>r����z�)���?�p졨��b���^|z�ӡf��͇<^���� ߧ�����`ќ�@�`� ���7'\w��37�k��߾m(���j��|����{����|�7�瘂|pae�����i��i�e0���9�v�??�7���at}��h�v�<^���d _>���j�?���ghs\��i�d쮓���d�x$$>`9mb��qr� ���ή[ȵ�jj�u��3��6�5�-y'�d����po���ɠ5��h�.�!�q#ϑw�׳�k��5�2r19��i.$w��r�f�&���o�`�v�vr%k]�^/dx��!1��!փm* o�[ai��<����>�qe��ҷhk�����o�4o �$w���do��m����x�#r�6y��y"�5l�� ����st���� ��x �x����@; ���`xy=�n 8)�zykk=k�%urqs��#�j��~0�$k�� �}1€q�ԫ����1o��_qt��f"or��2uϧ��!��uߒfr�mds[�szdj�,� �ye)�{�rc����lv�2l*,]c���m��.�ɐ� �%$p���bы�8�vs&y�c n����]�o'�� ���t*���e�s�x#^�.d��#�e� �q�!{u���b�xj�r~�,�r� ���'�� y#xp<#�7oq�>� �ue튂����k"�b�k(���� ъ�/���me��ꅧ�,��ԋ�x`�q�^�l�q�u�*^�f��䉹�ի�4�������θ�r)� �ɱ1���3�[bş��]�og�e ��^�uo��o�$wi��j�b��-��b��w�z�#u� o/����f�9�#4�d9����1 o�2;����6�(7e�@� .�� �<�ꪙ�he=�帆]���iʺ�9�i[i[�f^f ;c���2-�(��g�z��s�mei[h-w��`�oy[�i ^ ��8b�q��c��.���� �>�)�uf$tm"$oph��y �q���d� �ą������8k�@�v�����k=����h�t (g��t��e �� :g���˾dy(x =��u(����^mqj �)z�wp� $#�� �r��)^z� }�1�gj��j�6�� � �ody~e�e�xi]k@�/�]^�!��ʽ���jck_q��& ��@�bas8j�ybfy^m��r�(�g�ꎀ�*���4��i�"u�y��8�&��sst wi���qތ��df�9j�b�i�d y��&�qʜy��]��~��au�6��4���"q� z�9n�p���rn�}( �{��fe3%ah��w_��}�2�^��a 8�k ���b��՝,�σ���j˹j.�z [ro�k}�)~s$g�eд�%[be6�!��:]ev����2��d���:yp=qt2vf��e�4 ^�ji���j mˀ���5d.52ɷ�&���^�\3��5trizx�i�*'ﲶ�0��<1!�_���{�k�6�}�9�<3�ae~ �]-=�!��!��ʁ���*6� �};�b�u��r�j(�e�*�q�ܷ�mw~�%��s��x�` wl ov�)�'p�d���v�_�k@d�����j-�qa����v|%�qt��jnƈ���"�����8wj_ygiɝ9���p�uh���*�@�n�l���&��%�j�b@{�0/x��\9j�8}iw��c(z�j��.ȹ������0���׈����@�j ��=���v�dx����^�yq�n#줞 3z���0ݬ� 9yp�=m���a�zs<�)x��~�g y۲�����e%!p��(#���8¿6wճؙ%�[�xygb�(׌v�2 �jb��%[a�<�o�.���@m�ֲ��<1�^%��o ښ�,<~ �h8��\�g�um�ٚȫ�s{;y��[�};�3�� n�,5:� ���2x�x ž���/0�ժ�o��d\�{�?)o�������t�<g� �r��*.x��<���t�c�v��ݣ�;:ao͝�/q���h�sne���],v"�1u��@��` =�\*���g�w�����x�o��zpb�_��"�o�k��c,w ;a<��y�f_�suݗ�@�;( 6t}������ת8 ��?*n"� 7ӆ`9%w����@���z��t(���^�n(vd�#�:���se�[�!{ w_�2��������k���p���� �1��o��v̼���ao���&13 *ԗ;9�[5��݇o;��.�6_c�x� _�taw f������&j�����:�.�m�'��w��`ȩ�s�/�/�g�����=y��a�`�(���e}��=j��}wc���.�3覐(i�� o��u�kp�<�l� ڜ� �wl-�c"�r����u|~f^����k53p�ff�(�c�@:[θ�����8�r�.#� ��;a2��|6qx����(�ld8c��؊/��-�a�'x|�l��%�=$�' �'�k���� $��j���ҧ�xu�]�.�r]@�%djf�c�;���h�g cuh��)�d4�:��\��z��r��h��]�ȥ�p�u2�r,-beqeyf"���lq ����f��������u���g�������?�i�29����/�z���ԫۮ?���jd�%�f�-�ɒ���&ún��"��ud�rz�t�bo�g�s������c�� }�~�~������ϗ^q��tw���k{�oj7k��ݣs��� ��f���h�hs�52>2=2;�fd���g���=zm��~���h�j������[#��v���5ٚomh��:�uv���kz��nl}���ֿ�%�.]���i�7�?ؾ�������վ�}o{o���ƹ=�y���wm�{��u�m���g'�i���/o�1���?nk���������o|�w� �&f&fv�|j������읳�><��3���o�o8�wx��?���w<�������`|�z�qp�ಃ } ��,���ʅk^���ş..2z��� <��:"�u�gp��s�����q0r��4fgffڌ�3��kggw�^1z��g�;���3 �j]ܺ qpײ?o��y�w�?ܾ��������(�@���rߏ(�%a�g��tyzhz�q���mr��u�a��f�nq���&g�o��(��w8��q�c�0 ;�y��fn]8wἅ�.�����[/^ܹx������t��7���k^�e� ���� �_���gn>�ą5 るo����� x�7/<��w^�� �}���!�i���y��'�!d�\b�������'����h���������ď�}�wp��=�����������!��|��}�w��o޷l���޿���~���{do����?>���<������w��ѫ��so�ν�otvwn��c��;7u>��x��?� b���9��c7��{������g�ўg�<��=_���=_�sk���d�.���@�=o|h�s������g��o�g��;���_v|m�w )�w�^>�|n��� 4�l(�����*��t�%yzw�ay��| *��g� zb��o��h�f�:���ps�q@���ecv�l�3��~s(�/y*"�&j�w�m�t�y�1����8��d�cv���x2i��uxef�,ym֐92o�#k��dyo6��dӿ'��k�r9��sȩ�e�4r:9� ���y��lr9���m�d;9���� 瓝�����\hj�w��j�ӿo.�~�����x�����w{lۧ��'��\��x{b�����s��g����/�_j�������k�i��7�o�g���~��^����vp����vh[�u�tti�t��v/�n�n������n��@���������q�����zuo��^'w� ��ާ��7������a�}ho���8y/y�6��h-�6f���/���� m-����`�f�ѧv,��t�6�����ڶ��e���o�{�}�~�s��� �cl�>�t�w������g���=ڃ[�����/l=�m�v��޶f۫���mƕ��^��m��]���m� h��]ڐv����� o;{�i[fg�;�1� �4����4����4t���l.��z(?�#�o=y�yt7]|���-3 �-w���'����m�mu��y�,r'�b)�x�k�q�%���g���h�#�tl ]!������o���1� v� ��ٳ\ ��8�q�&�y���8���'��a���g��_2�5�t߿2x����$g=ٻ��hg0m;,���w2 �@.gzu��tsk �j���*�şanc��ə��ը��cp�<����z���� ��!�ɮ�����@��mj�����yl�i��χv���y�����i�6ڹo��|k|��ٙzz5:�ؚ���&ò v�,�l��i��_�8�e;�?ϰk��滟��!�l��~m��:��������ß�{_����d����wmӝ���#����y��h�-��vt;�l�����m]��r�=q��,5��2� �[�� d��l�� �©h���sio-m|i�}��;�m��������v~����wa<��m�n �����m�t��<�ѧ��8���o�w��^2�(�r��r�*�`��۾h&�˴����;��$~��b���d��� f�i�4��g5v5�h �2����6��>�2 �t�i��?�������2�ɿz����k��i�(04vy'�����ozh}���ҩ�w>�s}t�ɝ��7]�s�y�y�e��~mtȋ�/ ������:��yvfn3�vu�r��z|]3[���m�zfzey�w��z�e �ʺ��xfy* ��d�놡�}�uw����5װv���w�/3i�$7ln� ��,]�_l]\�|�\���r��[w�|턀=t���`�1l�6�#>-���sm�w;��qf���q:�j� {�)���`y�,-�[��ˑ�q��h�?x��^�ܲ��a�k���-s�ި�����aӝ38i>μm��.�t y ���h�����o#���� >�ɔ?a���gnw?k�1��x���=�3�ur���n��m7�o��s;�� _��k�n6��l|���/y�������|(=� uv֩{�[f�t��vy����g�b����5�m�lem�&sr���ˆv�c\�=���i�:�m�8�i�}���zu���ӎ�3m�#fd���$�h�s̻�n5�a5�v�b��t��d��\���ơ߰��(ӡ�|5c������ڣzk�ܜ����^߸j�\?��6��f�\n�����t�4פ�:4� ��2����ɖf�oչ��1�s=�s27/�jҡ47��l�x�a�����c�z�w/�\#�,d��n�=�~*fû�b�v�4�i��8ug&�݊j� ��|�?adg%���r�7�3m��m�2��5c�$4,i��h4ܒi���h� �g�f��y����t<(ժfk\@��nt�l�ңzt�ˎ�u�im�itj.)�z�: x�aw*e=�zu��a��_�[f� ���|}�e�wk_���e5k��g�7��"�a���m���jv6�yv��[&{}x��>��s{�5�)�m�f}��j����v;���f��~٠3�goj�ǝ�4;l����igq�����0�_l��-����0��s�� �k[f�0}���3��9ƛ}��a�:i�7.i�|dc�0?��>6�o@�u[�@�a:�a_��,�\�p9���5���ƞ�9��w�jf���� m�q�*n���8�1�� �]!�_���e��h��%����r�jl����|x�_��s�i�*�ůܨ��j쒕ƴek#}�y3~e�/��k��ʔ�[����;��e���]g��y�y<���4�2k ϧ�kluo��� s��{��օ��w;�o�����b���o����,>���>� *k<_���0��fz�i������q�^z�fo���/ic}.l/��y��:z�s�f�� r��a��zg����96#b����͓iþ�}�8�ecsq�~�ϲ7nng6u�գv&hx��k���q�#__wf�"3�>�����[�l�ywbv��h��j&è�ejn������^y�:=-�u�;7�����c�w�_9���v�� m]�6�j j�y�헇�4{��fp��o2���w΋m�e�remo5j�m\&�ϑo�u�nms�a3��3szeh��q�7l���~�d �cjéc�� �s��b�vi$ ��2��wjs���t�]��z�6 v^}�5��ě�l=���� v`�u\y�:o h 7qc�d��y�fjj��ϙl?¼k�#un�8 ��y�r=5�i�q��m�6,�^� df󘴾z]���_������q���ą�s/z�^>���ˆ���]�d�1?}l�a&��d���fl�l�ήy�)�d}���m�s�8���q� '�ht����i��g$��v�4�j���q≼/��gy_e�!�f��yq /'?��m���̘�m����4�!��5���o ���ױ��ix��]���6k�o �����d�mf���n:%��mk��k�jm��k���,�^\zz��� a.���e�ĩ�ts�^8t�:)�}�u�������{_p��cbybp}��s5�diy~�8p����\���m�n֫���ܚy6�� 3�טj�(�%��f�ȡް��yf4�wz]^�)��z�yg�i\k����;��j�b�d��u�xrc8�8jk��!�b�a��k��]��1`��1�sqin35��t�ս�����e�̰{��x%��v[�@#:c��s� ��z�t/[��s���<���ܱe��k���߷�%�f��d �xe�mcf�#�2 k6q%��i��;lq]s�_2��&�,����6�(}�f;�ҍ���j��w���"�k��.�'�� iu��iq��l�vs*l����ԕj����ֲrc©�μ����qv��au �im�v�d���r�o��ͽ�ݮi����|/.�fza���t�d�0���f����&|�sh�����,r.���)2/q�e����,��z�5-�l����3�l�=4\mt�?�bh�����b(��뙓y�5�6l ���z��j�0�����`5��#�o$�pi���������(gժ�jv⹦���u�d��o�a�u�o}���r�wak> �!e�� �|8��蹭ۓ�7��wi��t�� ��� z��l�klfϩwoe�x�1�嚠z斨�:�ײt�f������vլp����� ��&��/������4ȳ�:�e�73of�}}��j{�������v/���rkb�e�$$��4�ŀ�@@�ͪ�2�8��xؚ�c x �����c&����3v0�o��{߫�՞��w�^��2���;����,��}f��:ч����dj6l��u��m i������,�sȋd!�c[� {�}��4���*� ���ux�(؍f�b��c�j�7 ��o��%'���x����o��f�� ����_���j��̵ao��ic}�����8����[�y�uv�>��u��n��?�kbch�l�_����1 � f���(ac� (�~�i��?��� ��p� c���<���2ol���}����n(��|,��j*i_�ǩ�;�.䑟yd�(�u|k��r�-d�`/^\f��m��2�k;&`�7�6r���z ,w7��z(ހ{=ᦖf�<|��p��ů$��6�y�ԉg�$��  �,����jۃ�k���*z��v*��� �v�����^r��vk�q��t�����ŕ�hí��o2����o>�b{d��*�deq'���ݸ�e�ۼ_�"����� lp��y��x�j<-�)�> ��pya�n�h,}��{�]o{f-��|l�qja��2� �&��"�m��)��/��u�ixne��!n �z�0���;!��`�����ib�*�7 }�b�ą�i����ç���xkf��kl#z]� ���ܴ�r�;��mr=�@�`�%�u���;<)� �y�i ������\�csҟ����n�����f�= t��2�4�&�׿s�p� �א7��t�z��;����a�wo���� ���}m�#�1 �j��z�:���`��gx�td�2vψ�qk��5\�����8{�{/e ;v̔t-��0�e;sk-��`[���n�g;k���r#µ��2�)���=q�j��x��a�7��6� ��j ����b�8=�j������zq{1l�ô��^�q��j���䂾��y�0loi8ߪ �z�'l6����ۛ�һ�'�^6tpb�'���6l�dyhx�b��ܦb��{ # � e7 i��7bwp q���.�$l���_= x5_^�im��ӂ n��(��f�c �,*?%��$���ϩ�w$���8)����(��>�dp�����n�j�����u( ���;5'���*�3���"��a�o��&��o8�d�˭�2���'z1�wvܢ:qf�~��l�쓵rj�dg� ]t`֙s~@�%�s 2�t��e wf� �,����u;f����as�u���k��ߩg8]� kx����?�k;vwp�x��y 𿟃f�t�2ge&��3d���΁4]�r�п��r�5v2��d�,��8�i�����q�n���|�u�>�����k��lj�m�����,�maf_�{핮��y��� ?���8�s�tw�uz����knk2���r���1n:���v��n�@��f�& �dd�����<�3 ������{��$�(w�4x,��l[�ݐҙ �b~�a`q�=�t ���wp�ޏ bx��(s����������c���5k����r��r���sg��o�a��ܞ#��j�f�4�;xp�e�tx�� �.]��8��f ,�z{q�%qq�(����~��� � (�����������9�u��'~��"�zlhm7�ws�i�i `�̙k�d��$�7�-d����o��[��p���o�a=8эc��u����[�����^ ��x�[v���u(b�4&l�@�\u�oym����2�o �u�ji��0��'lw�њ�e'z���-�=5�$���i���� ȓ�����g�܌�dj�e��?��%�`�-��@�� c�8�����fe���em��=@ދ��֬�8 4��j�v::�i:|�0�ۡ�����0gm�>��0bx��a��snc��dgd�@�r��l����@���a�k�6���e����fm� >�pp{x����0d����c�9��^��o�)d��� $|�h�x=� �c��u��՜៭(�h������ep�#���q�i}��;he$o���z]]�����j|,3�bl7 r�k��=��sy)��s�i�r�r^���e��%6����yua�� ���7͈��mѱ���w�*���]�ܻ�v�@���^��vd�'t��'o���z� i/ �tr� �au� ���� ż�h�\�mr���<,uͪ@���u�$l��{2�9�@�y�]n�r8$�b7e<�n�q𔻤�5����חf���;��i$�]�c����lii�'���|���3��@o��k���~�0�p,��ʈ���6�\�cb��{`�ӽw.%���xqe����<���p#��z����q�s�n���fad�b~e���,��&d �w�†epqf� ʚ�f�� �te��'�ӻ� �:j�v�ײ��%��4�_=���)��m.���g�lq�j@���!$�aj_�g�f�=w���/��|z-�-j����jd�7'aez��{@����yo�s���#աx���/pôfdܦ���nh7t������;t��� ��op猯�x�pk�k*�"���7h�1�s�� ��/@a�sl e~>ʁ*���������5r�i����t/���$���� ?��q e�uҧ�-�k?�����f���������[��r�� ��tϵ�uo�u0�*z��y=��i���v���jӛ��2��h�2�jw��bs�ps��v3�xl˹�}dϗ ��q���ep󀺟wp��#tt��[h(���kj���*a��k*�ϥ������ր�d�ve���&�3��{#e�p�ռي�����(��y�xx�{�a,�xh�5��v*g�*�~jۤ�j�~m7> �zkw��gh�h �{�ؽ�� 2�b �0|q¹m׺��4vp�j�h �nd �p�����k��>���j�v�x���2#��o������}�"��rl�謲������n��|����*�����|�����[`#��<��ڍ�/�d�1�1 ��|�����x#��ul[p�-"!�� i�z�1r_�p�ww�s���������%�h�g�[)��]�?��n1y�r���g��ƫ��v1��ȣ%�mw���{waf�dp�.�ck2xaý� %�-,�������d�h�n����@��w���eؖ�a"�d�1��mz����u:龍% ]���%"���]ivcf�h ��ҙ�ov���yr�&���55�ṉ�e����,�}�q0!݈ ��5yl{�d[���6��1�w�&�a��tq�t{@��í7nh)k��e�����grox� ��>���)��ɠ���l��o@d]��q:�a�2�hf!�]�-v��kx��g��*�u���e�6 �����r�b�'�s},�!���<�5�����k5cqð�r�%��,� �a�fn�x�ߔ �_b�]�sh�uarf��q�m�����bzf{�7�lg� ����hq����fz��n|1i]����zߜ_�u��=5��z(�wӟ�y��uҵ���n����$���n��@t��ȕ#�}2i6] h����zh$��� ��w݄(��8?(���k���i������sq/�[�,�'����v��(�rd���>�m�j��2��[.�5;a���]���hˉχ(ϼ��p~qa�lu@�$ �pmb�sp?����-��>u:mxŵ���r}ć��;��w@w���y����qco�`=�>������4��;^f�[;#�l�nt���!g�౉>�e��`�߃�}�^)� x�[����'}��ݘ;�<���1w��{�p�x��|c��]ސaq��i�y2�8ܯó���1��f�i�i�l�,�f���u�v��<쵕m��6��^�k����s��,���ץ�ㄯ��$=�k����g������pmv�d�ѭ�k��@��1$>#w�t�l�&b�sљ��`��qף�yjq�܉sj-3��f�y���#�s��:!�l�,���|���*�q�v0�2���dũx����|��w�pg`gm�g;n�\ge~�k�pod�����z����q\�ϊi�b��8��}o ��@��lkt37��q_t���g�ƃ��hc�^�kx��<��i_m:ѷ�hjs պww!ҥ�2?���&u��m���u���9'^��e��q����5���3�� |�˦��ˍ�m�d;�r&����m�k狏�m:8z���8<��(,r�����ӄ{�m%v�g���gcađ�z�4 ���j=um �wrx��j���߾��&��2v��'�jعέ�z׿��x9�a����?��i���n �lk��_���vk k�.�m�k�b1l��e7���u�7b'�;�vr�'�a��;;g�ޡ:贰_�����t�"17�epu���d����]� v|k�w�@��:��;z ~<鏑�n�qεp��ey6�ht�ƿ) ��m��q7�c���1�0k���\f�ce2hr���q�� �& �w\_��<��_53=��约u!�h@�دrz:g��w��պ�b�i��6:�}�2ԫ�� 6&�-r�&�x���~�������q$��.f8x_�5�^�!��,;e=�� :ڴ��l���@v]5 =-�nn5�!�_?�y�9qp��n���/��/l2�s7���[7��9�$x �ҍ�~,�����ڒ��ƫ�3��r�l- n?ke/. ��� se�e�pxrn��׌�{b����x�%�w� l� :riw�š���&g_��c��n��i���k�t�l�g?f���23�{�5��չ��x��p��=c; {�s��v�[����k��c�sk&�����#�n�p��jny<���..&�~\��pjiѻ�� ƴ��;xt��r�j���m���r���ѐ��t��ybb�sg�@����h�m����ƒ��v�d[�*^����ˏ5o�mhu�h�p�ﻐ���u*��3,����y�5,>)sc�$�d�������w�[���ƒ m[l�9bc]ķ �o'�u�m�3������g��j�<�=#�ۛ�`���f횩<�vs��5뾓����7p6�s��潑�y�`/��6��5e�n�e��n1a������z���̴��no7�b��>�s��-�j��=���\1$< �b����e���<�,.�tpq�z���(��p�d�d�l �`ޅ�,$~xi�7��[6{��t2�r:�����ݢ�5_h�k6��* �tk�zbp��#gog� �e� s������)[��6$rq��1ŝ�!���mr sv_ߘ�tat:;)�[3��sa���� �㾜����s=�� h��� 匝ux��#j������)kߙ�1�r#t� � ���l�uݮ���@k�٤&6avh�km�•lp�l���ey� k9�8��e�\�̔$~:th�tt�:�� ��5�s*�kw���x�ƞ�wdn��-:�k�ns������y�xsg��6��m���n�1ܴѯ��ģ��].z�m}u,��t����dcw�a:<�6@���[.g�_�ỵ{*�(��%,�a�� ����|�����r�*ץ����o��o�k����y��.����9�u�mk�h�0d��`[���9�rs�$� �d�ճ��2�emm/�o��op٦��n�� �va�����w.5k�n�x�k�}�4ώ�":,mv�w��3o�������k>�o�蒺�i��m�����j�*x�m*� dͿ�;d�p�������q� �x(�o��5uc)��bzf� pц� c�./bf�2x��#l70��۷:w4��>�6��9u ���o �䍻 �}#l���u�0� ϭ�t�>ҷ:�<��r�q�ݶ��#�}*�; �v'���u=��=؞�������6�mr�}oö^o�q����g����)n�g4ep�]!��l����w�����o��ma���c?,�����͕�:�t�u�� �� �d�v��� k�{"z� �u=�[vo ;�����|w�c���|����q��}]��uu�v���}���^��}y��gz�g3�f4���6i3����b�@er� a3���� ن`����qn���`�c�c��o�ef'�hz�_k��������~����tjs]լ޶gt�i���z�ζ�w�-�b�x�p1u� w�ѕ��j��������_�n6u�3,>f�{h(♌<�� 1�w𹭉���7ûi�]�3��;��=sj�dl csȭ77t�v��=�������f܌h�6u�g���� b��<�֊)�̳�e�{߈\���f��h�v)�8�*�o����$yv�7eti��q����j��v�9�h�x�g@!�'��.�:? d�����.��c7�t%wu ����;�xwc{���bsܡ��17x�c�c�o��wm�moc^wh�� d�hޥy�癨 �tb�c���n��z�d^����ܱn�m���ڰ,�u>x!l��v�������r<�cf� ���8���c��'vц��>g�s4p,ffi�x��4�c���� t�f%ᒞzml�,���on.�f�߀$k)ṟ€�53�8��m�2�wi�ʼ7��]��-c��h:a�@%o8��w:f��p^�6�����eˌ����r�o�k��*�"~���f/ņ���k�rٜsv�׆5���d3�(��������ø��!�n���p�iȡ�2@ߦrh 5}ۜ���4nl���v96�z�,�j7lr��k)�5ݕz�yҵ��3�!gvg z;!��ء�\���=p�n�-�����v�g�n��.n}^�g��v5;o�*��p � bl! �a�9`���^�}��u�ߚl8�����i}mm�̝�� .��� j>�%v�hjo�9l�yϡ�t���x�1���ܠ�����}���i��ӌ�6z�=�a�?3r��/�[ih��q�`7��0���m3�ry�ak�t�q��uqu�i��a���ǯ�:ʮ&�g�g~p�&/ay���!���o�lg�v;�n1����ł��a�(��h�����;�{��߻�o��� n�=�e�{ӵ�.r�:�� \��7m�{� ��̿��<�!op8n�����7�:���y…e��-���'���&yd1�����b�o�swq�f�p` ��3(�t4�?��~�������-}�ڢ��lp\��(��a�]\xڲa�� � ���km�:j$!ũ[x���cv�jiӫ_�l��0~{ii}a�ӛ=��:l����u�2p�����sg�˓�m {z������:�a��qr:����{�z ��\r׳�m%?�w�u������-%���yg���sn��̩��xz�����p�r��si� �`ǖ�� >ՙ�hq�ܛud/53'�h�`��� ��z�����y��*��՜9]��ŧ��[f�c�w����x��u�û����ɸ��=% bp����* 1sa�e�� va5�\a b?f,42[�(v�^�^�j�/��l�s�7kv1"c k��^/<h�1�|!�6 �������wo,�k} ��sdg�e#e���0آ.���xz��wi y�������ȧ�j���dv�5 v�i��o��{/�z��g!�e�20k3�%�-�q�_ ��1 w䛱oq��a�b�ȱt�k}�^qba� ���,�r�=o���u'�93d94od �����ft��m�ыq�mۃ<�*kc��b6c�ýƌ�p<�����4qq҉��zg~ળ�2��q��h![���7���|�ӈ�ʸ�urqёs �������zw�����.��q d���'m q@>t ܼl��w��,5-æ,��m����1�� �s�<�t8� �]7��~�t p�����u~�w�k�2��lmv���] b���a��l�!b ee9i��ݸ����ʕ����}t_���|,� �3za3�*�l!�q��^j��1��v�1$��[��ߙp�#���g�о���v��ﺿ���ƌ� ��nd6�׉�0b["�`�i ��ɇq30j60�#���r����w̐����сn\�rw:ijs���f����zzc�?���t��|콤�a� p�%��u�^}k)��;w� ��cw��b�--bv5a��v���;�!���v�ٞ���z�o��y���5#�17d$�����#�u��j��c���2> �tx�o����8��m��u�d:�����8t�e.=)�eo���y���� ]w<�l\3d�j���=�=�|��[ڸ��}�6qzbs�a��n�8���-�u�3�� �� ����t��jh>��8���p&0d��r.i7a�d� pye�[s)���j�/.ư��ȱ��e����8?�o�7�v"�� ��i����2���}�r#ߋ�se$l���0�6`�������d�(v� x&m�d:(e��u�v\e՘o��cf�=0뚐��h���f���܁�,�؂�f�������a�d��hf���/�g ��]��>���Ž�бu����&cƈ�y0�[}t=o} g4t�����)/���:��qs_���fi ���6ʌ� pf <���5/�� js�yv3 `�踛=>fcd��xk0w.i��t밡�����^�qbw�p#(���$�c�ʌ�znp����rd����x��e�c�^ry��<�ec\���k�%���6��*9� $�ye�m�nt5[&�(�??����r0�};3�;�@w�}��gt���w#��{w����c�]�q�w�^�7�cܝh3'�(gj��# �������b�k;�mz m6�afoу"�s�|zfr��uq}���=�����ǻ�>��"�"��ג�x�! j�����ႍ\��a*�=��!��pm֙o4}ô;yn�uu��ĥ�e��!n�s�q�?�s�y8�-�q�)���p�sy�$�v���֪q�oh0�.�1�:l�qvm�>���p�r�3���z�i\;x}�`~؞ dyk�6mfxc�$�`7�a��kgզd�`[;���}y�ip���-�/�x@�� [��i����rg �h>e�nx��-p�ad눗�^�;~�c^k12��( �"�b����cq\��c,��9&���!�]��i���_�&:ց��k!g}n �a������gx���x�� n���ڼ��}�:�����*:???i�j�'�d��ъchc'��s�5=��l�#�@��m���]�=�h{{v�1 '��\��o��t��o����y�sz��u���c%�����j���4���\{�h�p��{o�����i���y,�7��4rds�b�y�w��n���#�ћ]�f۝ԕ��e�x9�i�zzwf�`�%��f� ;vm� �a�r��rz6m�۵:�j�f�8)mpة��s�5��k7mܗ�̿:�k)y� ,�q���y{���"���i ._0����ύ�zn9gj����k�Œ��&z�t*t����qgr���)tϝ�!���l0�@�n���b�!gͽ�a��i~������[����5wc�;wή��a��ۑĥ.���i�z��,�l�(�2�e��#cm�ai b�l��mq�l�$� *ƅ}t�ӯ �b���/���n�����d?���s�#�������=\�t���b ~��'���o'� 2"}��:�;��c.����r �^� ��q���b'i@20���������y��q��\a_/�o8p3��-�l �v׺�lc���n^ �ο5 ���>�:y��^�u��r��*��`����܄��"� п���v��3�v��w�5y�����|vw�����ros�.%��.�����ω��b�;sdsa�zǩ����|���r�x�tq�`��ͦ;v5؜-���<��χ;�p��j>���e}o�^����z��~&�~ b�wm��.@���d�ߋ����>�"�� �w���c��\�yxc�k�j���2��ox����������l�d��u��?q��ŕ����/��qcee��e�8h��!l��v���n��km����ǀ����o�8����t�bɾ-׶8�p�bs} �m�i�f�^k�z~����2i����..x�0�����jǩz\�dzq#� �"���]���̳�w��dzgwԪv�4�5w����-({n�����c��a��=����e���?��ya5[�f���ֻ�:v66�����]xȩ#u4j�n�����n�9z�����e\� h��g���e�n�-]���$:��� �>�gf͏��o.-atuɔ��,�n���c7�w&��7=c�䎯n�x����n/��69q�dbȑ����^���ϝ���fk<]���'q:�$�z����w�=��ƭ��o �j�^ �������.� }�f����v?�l�`��a���� �j���݂���']).��_�g�ҷ���ʿ͑��hj7t�#!xf�[ۅ{vat�g��9�8�w!m�w��y�f=�҆���������9�g�x�߀�����̺(q����jzhmh ���=���d0��t����iinj\� էs���]x��]���9���ys�zy��iwz���>�9������}t���'�p�(1��y��i���py���l/��&|n����v�6r|{���c�9�77cf��l�<�y-�e���a��ɺ����=�m�immj�je��� ���wnz>�b;�� :���8�ߎ�úu�לoi����m�z����� �����q�}�=ɢ6��ڿ�:�=�|#]���z|����t|��9�l�r��#���c����.�e�1���n�p,f� �ꋥuh��=���:4�����ޥ)�r�fz)q�:���ڷ����%\q�u:xd����{�mݫ��ng���va�ssrr a���ǰ8ū�l^4�xyiɜ׌s�n��`���΁�dԙ�fԫhn\gc�r�\�jy�n�g���k��a�~����=���w�2j&�%�kj�nr3�_���y����j@ x�& �����l�l��4ki%���� � �]֟��c��&�g��%��cy�y�s�ztq�5%�.�f<x�~fv�����z�и��57��� _8,�z�76���]3�q�r�r #����8x��t:6�����b����o���lo�����l�u��zū?��vb�ug'�^�@r롑vi�� 9՜�d�˸�ڦ�}�umˎ�n���bz�3�(\��7� 9�����dt�*v�����8�w�c�5�� ~c͒� ����o����k���xv�wr����ڃ�h��ݼ��?y����'; ��h � oo?�\�����1˿��ino�ܥoo�զ�^�������k�' ��� ���$�s� ǿ���e�cm "�\?ʣd��~�ǥ � 2~nr�w���ned?�y�2[��؞}1��h>����'0'꭪x?��v�c�ᜠs��;wi�j�3���z������ٳ�tgdx�*�� ��i�e��-j�"s!�a���ui�̷r�f�� r[�.�9����[kr��v��m��a.be�� �(w�k� kxk�1����r���k�� ���wws�˽�ą�jy�1_h߿~pz]� }�9��h��3�5�~�x���0g�������2:l�rf(��;�����g: ��@���r�;��q'/�m�sn�*�sv<#,��\w�k��� &vj�&�@���8��� �p�.���t6�)���c�l�չ��go�d3���3�rbs����n�e��o#� �?n{_�įmlܒ�2p���a��siվb��y���z�e]���� �o�uod����h_=���[pƴr3b�����ݬ��q��=|�� ղ7�uh~�#��x��y(;���b����vɟ�>�]; ^t�k_��5 ��ި����dpi������r��� ��qѕ��4�����gl4�߆�ٓnpwd]f�=z�h�s̎�&�/��\;�r�߄ݪ��~��� dz��no,�;(�i񘝆��^��}67��}���! v{��֑�f��l�aa�����4a���h���af��?��`����c/)���c]�؛�����m?ͫn1���6v~�r�u��jw֭�_!�x��)ȏ���!.lc )����<.��jv"<��k�l�8s zr>�8x�7����ӷ��61 a������2s�r`2��m���{�v����d,�_o&#wܤï��q=���ޠy%�vz�d� '|l�&ͅp�������qv�j���kk�[���p� ڟ�b0����:�h �i�wt�4k������>�t�㫡�t�"��| ��c�ve� ���p�j�ټq1ډ?�~�}x#����w�ofzԛ�8%��iz&���ts��4}*i^i�'ܼ���n@�{��2�u�g������w(���ĝ��k���r|o���q�`v���� ��q}׶�]��f<����������@�3ɓ��!;).�����7�-�q�ov~�o��]?w}�it.��1!o����ws���%})�'����i�-f��4����jy�b��pvi�`�[4smô:�o†}��s���p�e�c��g7ζb�1���(fґ�e���[�hz�%��1�&i��6�79��i�w�ujx%�,0� l�>�(������=�q@���bq12�bٖf��rcm��� ,~f ?vي��0� �?�(�mu��[�n�v4�k*�3�]�������%��3 �$ �٨�qc�ab��@p8�;j.���5�s�*y�3�8��j{��ss�r̲��qފί$�f�"��du� t��}�a7b��ax���uc��(�s�^c�cg4i ho��g��mt�3�g�o��j`u�&��fq�k� q��ms��h7��c ��e�c/6�g�v��i.4a���x-�v��͵0�lam�n��m��{vlx� �ޣ'r霡��d�-\i5|e��ι�f�ӝj(~t_;����{o��ƕ�������w�c�,�/�1(�h�m,@xȟn]c1库�� ���>o���:���>䵼tu�o�la;tsv���l��p钦��bnxx)j=���z��:�n�nc6����ksn�i���s��bl��yu��[���u�9�} �)�����m`l����� >e�m�x���0�t���oo��(�ٺz*�j�膮�:�����үv!�6�s�o��r�'³~`t�d jʆ��a=�i�i%�ob�y���g3}x�s����!0��ɂ�ݭʲ��=b�vfu�]��;g������|��*�3��� ������`Ÿ�a9�q���j�����l�gr�0�7^���w�q�e v�̓r�q�xg/�υ$pm.��}�,lu��t�ˎ����ؗ?gv��mw��������>�����.k,�^.������%�۔b[iٴ%�d�&�x�i˱�h�jv�k�w�e�%�@�r�ej�v����*��́�t�3���~������;�m�qneu�n�8���n�g��-�z�*�z;b�j�j�΄�!j#km g��0�i햐c���0u5я`p�lk�3c\��l��.�7z]�:���ol|��#]f��x衇��0y@�)/��s���'�u�z,����jo�ԙ�@$`f9�n� ����z���| <���<���s�l��t���q*u�y�tc��!����ux�9nv���s���:��ar�;4c��#�fd&�&�n���xg^mm.h�q��,�z�_�h7�_� ��0��y��al}p϶b��k���j��d���&e����ʀ����v���y�����<�bm�8od���w �lz��x�kb�������#�[�'��,��2 �o��2駡�d�pvj��veѳh����v|{�myxj�l�=f"����m$�~h?.���� _p�s���t[k�^��^�c��bku�'/r}�3�;j��[����o|{��z;d�s� ��[��!�ᛱ��l��elf>�f9��� 3~���x��*k�� �aw� ��-�q�>sn�[w{ �zg��;>u��˩����黡��;��n�ns3w�9 �)u�z��nua��sro9.�s�i�y�re���ad��q�r�]�t��r��3�jlf���-:sddf� 5�g��v�z}\���!z��w�m��� ,|��$'w�p_�k���@�zm�ήv�=&زk��d&܉d�h�3s��@\m�)d���r<�3򴟅�:���!����s� ���7�3qby0�����z�czӌf��f������!e ��3�~##��u|��f�ram.��3��<\���r;,u�ĭ{��q��k/�pg�(s��=d� p��vc��/@r?����uto��ss>��^�������*�@le0kc3^�i^ 6sg�ypқ����>��%�եq]{tpbi�v`g�m���aŭ�3�5��bu�`�e�9t�����n��8��-g� uotf�d�ju����d��b�핂��q�.�-q@߰��k��c�ky�.�x���`ck�ϙ2z1fe�*�ؾ#��janc�&c!����%en 7nïy6���ױ? �xp�l9��v3������zʬ�cω�z��bxoz��,"�a����m����;?;��s�9�@�;�3�f��-��e���#���>��������$�όs��x��m�җml&!m�a>� ��� }!�g6�נ�-�e-�t����e��thx.w��s�ا44�0�q'�'!~bj�<��2u�l�מ�?�w(�=��_��9�ı-���mw1���ź�ӌv�;��j1_r�c}�qot�0�2�:�d��[u�d�u ���������xg����p�!q��b��jco��ǁi�g��c�ﴀ;��*5�lw��6jf��l[�; a�����u�9�o���aok�x��bpy�]e�ro��j��vt�84xlwƍ�a��by95���h� �9!����ٚ.]*�7�y�>��s49��b���a���� ^����u��&���cŧ��f��rsz���mt���@;�g��y�-��g��j��oאe ڰ^pe��vx ���d�(76, �lg%=}@i�9��f]��–����i�1���u��ta����lj���jp9�a����e��c�z����o�ߞl;w��/pw2�rɍ��ǫ��i�:�#��}�n�l�&�4c���2y���tҷl�,kbi���� m �s0<��h�t��l��(��`6f߸ ;�� ۅ̓z3���ך�ypk�lz��ǔ��w2:������!0�s; w(�{�a�,ď�_'���!� ��hn5�f$>��al}��q�v� nm �d� ���ku���ymy̎��]u�!�ȏ)��vlۣ���y�,�"�w�/�إ�c�f��}��}k�o�q��\x�x�v�������˙��nq�;��́�mi�@ye*pϩ/!%�_�"?}��e���ނ[�t"�������z� � a�ȁ���t�߶th��;ʍ��m/�r�����?'�3�*y"� t��g���$�,�[^�b�er]�f�e4���!��o!��ve*��k������&3�u��w����g�ul�i������'&��2������$'��r�scl�÷y��i?��0��=g?��w���@����t�ݜ�喊sd�s�:�y=k��u�c4�����a�x�e7ꏊ�s��(�di4q���l]p8�f4��(��5o����s,xf�ηe| ���,�x�p�@�=m��̊��wʽ�����b|r���b���uu� ?ݹ�tά`f~b��62�!8�|��?��x���\���cd��m�(�bpe�gd¼��^��wf[z,��a���v�h|km��i��0ra�? ߾�?|[�os_$g��b����5h}��$im��;�w����v�݋0�4��n�7��w�脍ja}w3s$o�}y�m�׌_�ȋ�p�ʽ�~ z����4�e����&������ſ߇�j��e)`1�#3aj��n����ݡ%iy},�r�߻�i뺷�q���rtv����6�b��xv���]}�u���rq�^�_�8ײ >oc?�u����f\t�y^v,��f0\��;��e��i=x�a���`� �����l�>2��6�\_*v2hk:� gm����i�]p�dy������n��a�b ��ľn�f�~�ս��u0mbc1\t_4���#��_%�������c�:��.x-�3gz`�]o��a7 � g��$_/ ������=7f��η�� =h� �#����曗��]x�4�nj�?�8|�:3l�c�y�8���0� �uj�)�]wg�ʎ���ܻ�|��i��m|�ޣu�c�t"���9����jvx�g>�]oi�@�33k�o"���j�$��yy����f:%vz(:�lu�,b��~:.u�v��i�ހ�q/m��o4���ٲ�m�!�nu�]y��2�rtl^� �z�y��à��� �c�,/�猪bժt�v���ȵrd^7�dž�zq�z��[�f����7�ò|% �1�¤�����mh f�3�˥g m9�� �r�_�� #�ܡ���x� ��tƥ�ccη^��@�����m��f�d'��-�kp���\�o�6p]�����t)�i�#�fr�(٬p���,v��&�$�a� �>�� ,/@���bd9��gvt��_ �3��u_ve%�2ԟcz{����]��2x1#����#���*9���l�8�����!��a��vxjtot���g����|������[��l>����t�r̈�iaң��� $s^���fe��@>���r�>q����� ��9��v��{�6ez�d�'8�^�=���w""���ia���t��:�?1��~@�<��)��ևu!��a7�p`�0�6?]���/#9h��n?p�çiji����ĉ�v�b r����%r�^)�r���.#�1�$" �c`&m��d<"�$������e�j��<��jz�߫\e"��o�ȧ�i�q������>4�u��o7����qk�e?*4�$zl0o�/��w����i�|m� n[�ee%�)s=�qo��l��{���ߵ���;̴gx"6������i �b�s|���f���gul)*�v̗��� �c�ӕb����^k��������^�f&1�ke��]����l\u qe���#a_i zu�^�7����;�=�!��icb�f����n f��ֆ�y��݌q��{�����r�r�|��g[�qi��d?j:���ff_zz����t;��k�x)��7�kd�ހ���.x���lv�� ��l�u”�me �����vv��&}�6�� xjn�;� w����}x7}`�$3˂䩏:�w5�&�=�� n��~��1���ҵ�å�k�! h@�t��jh���������q4�e<��c"��ϯ� tz��ku�� v���0��z �e0���4�s����](����% ��<��q�����:ԧɂ,x��~ u�7 >�y�6 ���eb�t ����uw0r��:��c\�ne9��y�h@\tr�b�-d��ҡ�0%�j�_0;��-n!m�`�y��f^΅�lg��ӱ�h��pm�^�b������՚�zzz�i�?f��~l�z9�lag/f�a�9l�g[���9}u����{�ӣ�2ޅ0��v)�wn�^�e�����������,����v��k �a�k�{���]�b�<�����¦w�|����g�d��;'vl��r]�2�'��e^1s��s��?��һ�9$�g��_�鳽�)5c��a���?����d��s�u� ��,*�>��֯� �kv7�wg~�`z���쌭�ɹ[%��c<<�"��4l ���p�� n�m�p���^��w� �]k���1����7ok�i������:�/ vf����a�������zm'~�ry�� ��pf��%�*�2o> �w)gog: �v�]� �b���4t'��8�3�u�s�����2�#�@� ��~���cb�]`�j�ʸ�d���f�v�p�j��9(�xh0m���m�����i��@�8�g���~�r떧���:v�����e�}��b2k�ެv��������ge�-.xβ@�p΃e�������}x7����՝��a#e8�y��������7/a���;��6j'�>��� ���l3��k��g���k<7�h���2��1�� 9;��j?fr?&�#�>fzp&��~^6�k�v�ȶ�= lu�l�k�|�g�:�n2�:�~�"r�q��o���c'�tw��r*�dӧ��u{����"g��e��s�=����c�����!�c�sc�,��(|t}:�1s�_��ݤ��*��۟�qđ��q��m�zct�6 �˄i/���mhd%ߡb� k�.'� @�(�lrģs��{,}��";�>ng��ͱ%����eb���'�n0���l�m}��j�j�j��#�ѹ�v�*��sr���-�8g&��go@bb�:r�c��ɭ?c��% ���^�v]�|'���ֹi6um?*�k��e�mf?�\�}w�](������~ӹ�a�7�e�r�r��r��7"����3��wjb��$ß�d��h �˫:h���s���{<���j�ߚx�9���#.����������t�! 歿�3�� �����_��������?/�7c\��� 5fs/�'��ȷ�6 m�ow v�q q'����� o�`0va}��������`��2�ozdo��q}iw뫙j{�kb4�\[{\�^� ��ʸ�s�!�,�de������ ��j��j��*^?��4�ha�ؼ eq���had�<����1v�mp�64����e:�w�o�f2a��po%��n�� �n�����h)�i1���o������^f��s�z2��߅ ���sru*�b~\��8%�u�lq��l��ݡyw��t�~� �s��ٔd뉏��o���md?�<����*�y�ll*�}x�8�s^�ӕ�w�7 ]��~�7�zs۴9��o�c� ��>vn|��a���2� �q�2aw������b�ե-�>*��'�|8 #����z��&7go���d��#_���� ����sk�!v�&"ӗd��ky�� 1�eƻ�ڎ�=����r;����x�-=pz��: k�;�/��� v`�$�zȑ{i�[>���>��"u� �>)�oxq��0o2�5��o�>���xʋ�rg�z� ���5esp�ټ�6�ʥ��h���>����r�z��x��j�6m"�ǵ%��_�y�� �0��*hk� 5�~x.jn�"�f$ �9�w�aqɔ<��tl��(:j�k[vo��sc&��c�cv�~ѝx�,���uox�)�utg�ué=~z��<�a��h��>���x��(etmk���2��ww �i��d�1�wk�z\ro��z��[�}|�������"�c���\ɴ�`o`j�9̊c�eʮg��l�j[xa�y�4�є�d�vv� -�kvqeċ��ki;dudy�ױ��{;]8�{�)o�w޷'?ѧ�/�op����`v�f����d���!c�m�(�(ǎ��$~����(?���� �} [d���a� �iv\c�/�w2 b�z����!��.�n�_%���8zf��tn��:� �tf��v!����v�52��s�{"|i?�k�?��b>z�2,*a�������.ԕ��,lw2j���w� c�����3�6��ph�7p���踝�z�x�߷� �€ja0�󁘷:��oe,|����z��ٻv��(��#�a�i`���p.�ٲ5s������7z��z����]��� �̜�c�r�5'�����e}�\6dd'e�x>��~��j|޾�uvh�%�:q��6gb��f5w�/���dd��9���tn�c�w �']��fߛ��a��gz��av����?j��r���5�*i�|�u���uv∦�p����|�o/�6�7p�f�<�=z7e�a���܈�7� ϩ�ofi�h$��s�y��q9c�e7uxq�~q�wne}/�~%���q��2�$�vl�u(�id6��5� ]�0��,��y��\bu��#��)�����a�k�h��w �o��,�����u����v���qo��ٸ�g��� �=_vr�̧ �e4br��߃5�&i�n�"�to���`�ѵ�n�v���1��g�af��yg����:�dozw����z (q�f[c8����7�n����gz�l ���&4���tf�)֌'�n��u�x ��t$x�=�q��n��c�2p�s���b�&f�����x�ܗl2��s��\��1�h�l!1tsk�˫��ۥ�v�9>�&zqq�&�?"� �����d[@�h1`m%~���a��^�9�� �bdk�q�8�-�v�,ʻr�y�e�[ o&)�i3=����ŭ�tl�3�_�.s7m�>�q�u ה�˾�k�u]��z��r���c)��w�}k��ѻ���hk'[��v���bu71x���f��f�gw^$d�k���\�5�(mq��б�� �gs��5�q���:�eb iw���pi!����&cfi3��f��v����o��r��3��6����?f: >� u������έ�?��x���`����0i���� ͠z�#�m3��9�p�k�ϡw-�y�g��ԓ <������fx��\�tn�>��̃����ك��\�m)�b7�����i��a\ti�e�7���k/j �vs��k,k�z�ܢ�@���a5��f�ybxi��%��zd�:���-@�}��@�bf]{���\qz �p�z�s���n�8�/5�d�3���;j�r�g�}�p����&�� ϳt ��}��?��v�f�0�u &� ?;.�t����pѕ�޵g���ϸ����[j�^�� �px�.��;ݨrt[��1�����&�={j���q f��/�g�qc�����ў���9��9���[��`��0�=�х,���0�[��}'��"�7k����ŵa�ߘs>�w��;遉q<�p噻�k; e�j�m����^ �������3q3��9#� �w���-���&݀�ʠ�u�p� ���� y�.9�>�{���� m\4�����h��yia{�s��� �r�ƌ w�и�a�z�����u��/x�f��ƣ7{s�'�d��z-�)o.�� ���?u�i���ͷ��z��qȃ��f�ݮtxa��]nl�ke/�u���v�\0fnf�]ǔdix���il�l�)e��lwg:�p�i��^��^���ꁅ��,���=׳(v}����� _���(�gy����e���)c����j���q��n2w=�p�h{����/�6�d�u��1�x�� �z��iкu��m���f��9����w���j�6�/y��yj�inj�i��f�`����f5�i��q,���/�8b���t`��c#��˵�2���0o=b��|��9�l8ñ��[a/a8ѝ������\���fq��!�b�(*j�����-�br佌��x��z�waez��,̊c;�"��n2fe�;�o�]~x�w�8��-�k�u� �a��p�o�b����|�fj�x#��~��q�f�k�]�ʼ �� �>is�`عlu )�x�[��l��w ��<��z�= �r�í����<�� �ӳ����@j��zó���p| 9��`�eb����c�0�q�or�f�����(�@�_��$?�t�8�� h'����(?�u�a�o#w�����sf��!u "x`�%!:9he�� �$���?/t�c�q}�g���<�m��b� ^�,6�>�^��fؿ�r�btc�?����pql|*m���� g����7y���u��pzu]!��\���qc�=��3��p��u:�u1o�qm�p*ڔmᱱ�f��i������b("m��ō�#��$pxv�}���[��u.< y�v����a�f���\�l��e|j$�o�1��}�]qk��<&b�ue#��w������2ٳ&���d�� ���nm l���spd��( [��eu� ����͌'9a7��pz�5m���ޤͼ:(�ut�om��a��rl/�嘞%���"��������8�����b�%�=�k�f��� �p����o��a��d�]�bnw o��2��cn�)�4if������t�sn���s����i�np�*u�#]��q'zx��# 29��1�oo��o��ee�ԡ#��b�󇇇zu���d z�k�)��l0����,\0&tw/��쁅�օ�gt��؎7��jyя��lns��k�*��b^�^�)�(p��o�ʹ��w:,� ���;��:�j_���|��e˺�oy���9܆�=���2�n���(t��,r‰��m��j�а*�n�3��r#�i\�x���9�zz��y����{��;����wӻ�fcw�jr�r(���t���� 9k�v{m�i�o.��)�u�:n,ר��3&�h��' �g ��#2j�����*�prc�m��xal�g��il�~�r�=�р�p?i�����v��f�^�6�k��yg���w�vⓢ�" x���e��y�xr�i� uw�cf �l����2=>�cw�@�9�b����b��pvep�� 2��r�e�,x����]�s�4��7o>'���s�ʀ��f�����9��6a=�d ����j�,�9 u ^q�j�����5 n�usmx����?����l��d�e�m~����/l{��?(���n�x]n�f#]=�}���4_��a}���ݏ�ծ���ho��z�5g-�����r$}�v�e'�to�s��n`�;��ͻ��v_�gu:��m�� ��%ӂ���g���#n"a�h����l��r�s�c�3���e ���n_�x��3���9���:�s�qj�5�b������m{/y�e�}&]ģaّ�;����|� ȧ�~�?i%�a��=�n�:�`!m���*qqi������� �!tdw���$2�r!p���1�$&�t�wo�_]�e�b1�)�xc���.��d&|x��b�v��t�o��ˑ��r3ό™}�)d�� f��n  �2�x��z)�x���l�:���aauf�7��pr�h,���x�c�rm|ޤ��a�wlh� �v�z�'r��lŭv�^�-�g�0�^��v�/š _�r�zzƌ�_� 9�j���� �v�68^�=br|p�^9p�@m:�u"�n^� .�y����:\o�f���ْ�m$� rj�j�?n�'|y! �]˲ ��oar��n��^;���c��u��2��䣚�k�7@쵈����i�5:��ȟ̈�=[d�>���}yv%�,رk'7�t�ʩ9[/@�g����j���^�(1abcc"�a�w��e�^�^�m4�7��[<z�m�!�* '���ƀ��0�ǿ�x�-���g�*^��j:]�j�� �as�,"�)�%jfײ�k��uy���\֬�[�w�����վ>t w��{�h��q���!b0�w��p�q=�3ɘ��f#j�����:ex��c����h� ��x�� ��gr[��5��y���j1'hbjt?��y��10��#x%"���z2�l����/����8.@��eb�y�=k��e��jd�r��� ,9��9e=��"����9 hao8ʉ�-b�1ě�2i��jp>��d$��phek��$�ə�$.�x)*�\�����?�i-:��"t�c�3�>�������>��a�����m�� �sr����\f��s��y=��f;���yٰsx��9�b� �az�?��y�m�-��u�'d,����/�5���j��f(��c�� n��<��� ox&��j��y��"�� ����ߞ�u�vt�.�ҳ�iq>?c)rl������r�s����k�s�min\x�ߧ�j�tv�f7'���9db�s��.���߬��or?�\������w�t��,��a�t�fx����c~aҩʎ�f�|�e#" ?��;c�!�v��=�1�� �j��8�����/��byrss;9�y< ���<�n�� ��z�-\z��|ǂ憌h^���� ~�俦z�k�cn @�[kql"_:�>ɢ�^;���1 ��kl�m{�h5��9�obܫ�`ģ�%w¹���b�e��w �ʸ�\����&4������@�3�r9o4���� ao�r�s�\���"���;w_�hqa �5�����\�#����4�!^�x.e��%����xmc�i�`�e�v}o�yo�gd1yt�� m�v�\���nv�v�"wx��q�ս�/��‡�q�o�����r=�c� 3�zrbh����k5h"�m��xӑ�4&���s�ǯi� �=�4j� ��a���&���ܠ�`yԩ�5����k4�w����ݨzg�厘� ܬ*/y�xe�� _ i����q����v*�e� -� r���:f��yģt�<��/�o摡�j 8{@���ҩ��uwh�e ~l���k�b��yt�����~"ɲ��ԓlj�瓦��xu�( ��g��eg"t����9y��_w��u9}�ڟdd]ڊ�(���o��2� �ע&�į��#i�u{��8�1bìh�#��jt�[p��0�`e5ռe_�|�[���[΁�s݂�шxpg� ���\�ȃt5;�ş���s��oe4��9=2�vj}��-��̙���ͺɠۿ[9uyvʡst�5���a�w�]lr&e py��n9�����g�^�����ⱥ~2��ř��"�r��fw0|1Ԩ���}�h� � �-��^ ��k?���0�o@�=q ˘�6��m�1����lmm�n=��ƌy�_�~�a�������/� ��v���q쮌��sݮ }@��'��)�ўҏ�n��i�cu��g;���v��rt2vl�n����y��u�uc���b�~ߧܻu e^v�ek}���a��h}% �tw&]���e���uoe o�x́�`�pm|�(é��e$�x���7��y\���u�|q"����i�d����k��r��do)_<�����q�l�x�1~�)p���e���֌w}ʸ���80�a�]߼nt��������v��8!���p�{ağ���k�"5[�w���f���b��c�^�kvq5�bw�qsv3��pa' ��o�w�2"�z�"i�-�e�щ �b����z�#�j�)d1 � �s�e�e/������)n3_c��$ 8���l�v�ro���۫��m�f]�w����h���:{d0��f�����l�tryʾy��l�%�b�n�;e����_6$ s�c]�l�u7梘17���c��qg5߮(�av*�]�90%?�txmb5g�o�n�y�`j�٦ɇ���}3p���{�dҝ�p_԰:�m[r���9[y���f� �xb/mƒ|�� �����뤰��es���$�l1��m���g<���1qb���cov(����rժt{�#kp�ʻn��"���u��� f��eu����f�.<�;t-v�'��e��lgk0*o��$s>7��adѩ� k}����������!�w�a&�z���;\���"y�p��k> �o�f]hx�d5�@�1$ш*uho���� m*��2��fdq^�`� k�t���o��l,o�&'�_/�9 ��f�v�0q�ݺ_halؼ������n�y{ᗌ������|�r��v���d�n�7x��x $x�f��l��~��{�ӏz����_g����w=��!g�:�������f�a�تp'g��l��x��`����l��d��]�j���e��}h&�zz�>�ͽ~`> �l���(˭޻ups܆���i�z��}���six���&p��pb��jt�6b�pu�ykj���2�=�b��ې� �ѷ��>���{�' �n��w����^����}7�ut?���n� �/t��!�����{�.�4�'x�>�n�=���.uڢz�n�v�e�g�sݷv��f��>g�*�y}�u7� ~�ܨ�nӱ�o� ի,zǣ�qc�%j��5w�g�����i�c6r�bg v��f$��gj�a�s0k��t�ob[e�fb&>)���n�_y�>� * �� �!��m�ahb�wf�j�7(�#x������ȋ�y�g� �!cq� ۉ��� s/�hv���"�t5{q��v^)s,��?� v� $�zhi�%ϗr� t��z7g�&��lj:�|v�݌�k�e�s�� �vk<� #c�w6���s`�c�5u� s��, y�z}�.7{ ".la� ; 80��� p��u��{kn��t!bn���d��8�[b=uw��qs��x_�'�5��:mj����~b8յ e�tr=yj�[�a q�an%�y�>g��,��~xx�n���g�.�cj�@oi���(�zޔ �|�`���p���-n��,ڶ'z�-�g�w`��u�b���*s������c�̚�58�p?��h��5�� [kkw ���@�^�g�ڰ2gn�j��f&5{qxf�֛-���9����^�;:�x��sux�1h՜��z)� �n;��� uحp����de�{��b)k�^�z�y��|��a���] wz]8���κ�c�u4z�h�۵ʱ5_��~s�7 ��䶻��;���=|pb�̑g���l�:�-te����u�nk|��mk ��9�7>!�g]�lglv��u�a��[8�ϵ5x�*ƶ��dg�矀�/��[��p�r!#���z /��ޘϑ�� �ū�&z���*�c��;wr`�y�k�[ljion�w�r�g*�,*��t��m(�m:�v��z��9��@l���� `̄mܝ�4ų�gqo�h(p�q�flp�}�g�q�b  nl6㐩���g�$��u�2��a�|̭��?�n8�t�5,�mv� ]�o���@�3�0x�4m���`�gz*�c�slorr��u�'k��5�ki�<��[ ��v�,k/y�)� ����mx9�mߙ��:����܊#��3�d��$s���^�k6�5�n����^_�߷ �0��s�#�k�_ �����p��x�l_-4�5yv4���%�'�"3k�� fai f� �et���u���͚u�!�#�u�a ���[��m�<��͆f\�ư�db�����%� ���<5�`w�y 稹l�.]��n\�[qq�[!���5��u ����r�p��9m~��t�m�4���s�� �r纶��i�w��z��p�����o=���8|���apy��01j�sh?�0���.�×�b�q���� ˒꼺�w�̛�w�޾�w��t�����t�>=ӳ�=;�% ������!�6�v@�� y�q@��"َp���!@6���������w�=m�tmu��z7�s�s�;߁�m7�,fi�1t` �"��c�� ��ک���c�r���o�����,���rd����=���qa���@�g.a�� ������s sw2� �����~o] [�ٰ�vee�r�o9����y���7 vqr�o��f� ]��k�px������>���4g)u�����pks2��=����uqv ��2{�� ���5��tn�0�����i;m��"����$�-���j����uql���r�3���rӧ�7�$�2s=��"�_/u76�2��펥3��vq0�gz�ke\�> *� &�lܛ����m,����ak�����7w=j�2� ��=���%|j/�$�c>�s1�lo5��pi���pf ���6w � ev�u��f]% m��6w�β�� �z����� �n�8��,~��� �\�t7d�԰��չ�fbuxf�b'����hm�=\�aڙ�����w��s�tl��{�5�qjр���sͭ���� ��96 ���}ύ%i�;�!s��g���gg�oc�*c��k�hi:.`�x�u�@�mu�u��e8��%��d:oilft7wl�li�aiؘ�&3a�gw����b����1����a�u���%'u�u��v��,�|�|�rwf����4�1”g)�2mk�d�?�sf��uz���b� ϫ���bp�5����nrpi�����l��?v�]q� �n}��vj����>!�%��4�ޢ���:�~kz�`z�$ƛ��f�u/�?�w�o���������}�t{���������c�8�b�k i��b�z�|���y��s�@uo���mc�>ԧnۦ��3�1#�u2nrr�nsa)v������yl �t�� î� �h�a#����l�a׏[~%r��j���vj�p��i��i����4�w��w��y�ܟ��&͵n�܂|/�l=9���e� �u��wlw�>�(ywm��:bc�cq�0yq�0�s� fq����2�x��1 �;w�x�޲����z��8 mdu�rn�� ��^x,�t����̬�u�� �p�e[̵a.�'_nvl��`d��彵����dg������f���{�(���*��a�����)�5�qtp�����c��q���a� ��pc<:%�eu�w\b�xsmgω��y/����\� �%�ոz 0��־*s�֔\j<�%π׉*��^zڋ�tg �g6t@��c�9� ��r'��|#q#3of$v2�fr�etf�f}�p�kg]i����i]s���\z;p����x��ˆ9u�0 f�~pa;��[fd�^�q�������&���t>i��\�����1��q�vu~�׻�1sߎ272��swwﶸ9�/l��je6��xn�g��?�<�d�z�,�7�x�-��� ��;���տl=���?smi��㹯*��c� <��  /���ku� �jg���yz�hm�ѿ1�mnn&�9�}2��i������rcyր���4�笨�*n�����i( 8z����z�*j)�yԇf~0Ԫ�<���𯮭��\f]� ��� �� b����u/ҹ�şb�e�r�i�o������@dpr��k�%��z�,w`��w�{irrrjτ���k�~�$�y��rb�ǵ�i'����?y2\�$�h��vθ������"��i���g ܣ���3r��?�a���xۿq�s��n�#� y���[��p ��y�w��/��]� ��~��s"�e�y�i�c4h�>�b��j-�f�x-�=�ԝx ĸ�^(�~�#�d��8ܕ���p�*uvew4og�i1m̢���|��z�ay��|���?ε�$�b������1�����ǯh�롔[; �����ޝ?�������=g<;8gx�f"����q������p×=�g�0we�}ر��z�����ƌ9z������k�d���r�)� y�4[h���]a��!��bj��� {q"���{)�=t`z�͈����c3u���4p�f?9���v�, f����w��bk�\�جb�?�n��$ ˦g�%�n鯼����>�&ys^�ȱt/]g��t����6t�rs9�t�39��4=�:k���aџ��:�"vlf��Ϳ���\���ǫ�� =��v�?.~�����0�wkk�o��ϋ���bmor�)��q[/#�2*w %k��s&�o*ϼ/ ��&�y����:�y���6�� b�t zbx�`""��(��^_��5)೶��4����.ujb���j�(��e�w���gb��;�� n��:k�8�j���k�-c�w&7�� 2iphԕ���u��a/\y���&�i�lч^{�y5��| ��k��: y����g����p�y�m�k.xjxf�y'ӧ��֊o�/�j�j��d���sz�v��f ��ӊoox�xb|���o|h�c�8f�[?.�9v�s�w�&��e@c��i�֕�_��$�y��i�!b\� ���'m��d�|6p���m����u��q���e������`n�î�r��ߛ�>m��\�3��c��dz���2~q��*l?g�^� 5����9ί�qx��"xnz��w(� ��b=��<���*f�a���w'~a�݉ߞ���z��n��f��z] j������q72%ǫ��fq|~h��ػ�e����ߢ6l�3u�x��jg6w]r� ��b����"&����ѱb�*���>�]ݕ��� jr"ב䰪�;�bz��62�z�3�_4c0�&wû�2#��1�u�d "0�yb�t*�յ�gn��eը�e������g�5єfh'��.0�,ƭ��`��5v]�6\�ף0��&��iny��$��s?9�gtq�ʕn�o8;r�9�3ax�36ڱ&s9�~�i�.gw��\�~�<�ٿ��s�l��hw'=m��ŧ֞����0�ʀ\�� ����df�j�� xӷ�x�&|�:�m��bfcǻ�a�یm4�5��;͢��@�剓�f��m� �����o�e��� ��q����w:�w�s���ӂ�_��=��」�d{����o��<�o���_��r�t��c��l��3= �� ǣ�mev��od�r6��4w�e�la�|�o ����ى ��qvx��fgf�no�fu���z���ox@�b� �5�*��8di�c�u��*�ѐd�lo�t#��dv=eaِ�4������=�{�������y��f� �r�,��d�h¨��̐� .m�ku��q�bv�c�%"���}��^����j�p�$ͦҁ9.���d��1�g�-�z�o�h�8r�.���������w���4��d�������f�� �x�2q�㹩��v��&��pj���/��k΋y��eg{%�1�i�byi������i2/� �0r�4z �s1����tv}�jw�x���zd'f0;����o h�9�:��(\�f�*,���'�����s8υ���qx�lk}}ii#)-~\���`�tc��ifk�_���dq���a����<���ӎߟ.�a=��#m���*m\� ���\�q�,�~/��� ���g���f�.l�'���z����� ui�$td|�u]l̡jl�r9�k#��?y��jwɔ��e�qr����h��ndy��ۻ1�hno��@�]j<���\��nr���-ӌ���>q�2o����w��s1j�=\g`���a��̓𺓔�x**��(�5��)ƅ��!0�t�����=����?9���o��ž��hx)6�x��x�1�o�d���_�>u�t�la�m-���h������`�h�[*z���?�������h�/n�2�-a ǯ>��""���4"ϖj #�v`�����@��������(r�q����8����g��3nl�?뷶�� �q�]��gӓw�kw��sx�vm4`۫k���$��hƨ�*r����̹cqq[��jfȋ��� ُ��;0�z�s�_���#�s^ �z�����x�jw���r��� �`ǵ����&ŏ���p�!�=~��ǟ��jwv��}ɖ����s�o3 s�ۃ'� �r�yp z_�#{��[>y�v�����4sёaa4��)?b��4��yނ7���;]�s��r�� k�i.� l:��s�x��<�>�� s�{5܇�_m8h�"ta�5i��hչ����޶�j.z��e�y�;�� cޔʿ���;xvs��7t �)��{]��jv��j�r��է��^��ǔg�e����j���_9�bl�\�j��3��kԃ� .�z� f�6j}� [�c��n���&y���s�t}��g�b51�<�wcm�aɒ�r@�s%@�_>ן�2��sq=�ԕ�ҳ�d�sx���%��z7�d~l�f )�b�d=�\��y��|3�a���yh�o�'~6'��ͮ �t��-�4`�u��uj浌zܟo����q�>�_ui�w�/�����^�f�\�u>jn���x;�r�&���b�c����esv�1ەû�b�x�0�j��ig� ��b�w&wc�ݜ��� ��8�o������^��®d���-4�~�����'$z�3���-g�. a�ݨ� �m\�a ��uw�y�]i�j�6އiq���[�#@td���� m����o�k� �c����;ba��do��}}33�;�br�48up����b��*�pw�9����t^߿|i�y3�pus3�k����g{���r�&��6�c���#��u�f���t�sn��������ܹ��fz�@�k���j�a��:���`z�����ݻ6r\y��<�t�4� �.8� �������� ^�r�������nv/z�ϼ�\��b n��7d�pp� ����g�['r_��}\k�{x�t���턶o�� xe���4�͋�-o�pg�rd[]� ����k���5#�v�?��v��r����a� ��&�ͨ��1gq,n�"�� *=w��z��m�\�`�3����y��m��*��lq�'$�6�f�fx���j�n��q���m�ÿz�\^b��3g�n�f�w"k��a-�"ҁ�7i{%�d�Š����<�$�i�aҿ�p���6*����io�s'l���;%�ʋ 9��s���>��qŵ��; �����/��o<_1.��hqg=f^dx�nz�}��=��s�c�>&ossk��� dgv��ß�!�z#o��8�ss;��þ�h[-�����?9�gw��q&t�g�%�n���nοuhe��7�0�ң��'~���ӝ�\(f�����6��֝rx���k�}�ο��vp��)� ď��:8��tl�>��ޤ=���㝝�k�9w�[�kp�e�|~����đգ0 |��a�<��ȑx2���s� .�m7�7{�#� q�9j��"%o��?�yv�02�����zy2�{��� �^sz o�g� c���/����vm��]ܫpk��2�e��n��j��`e�27sվj�g�\��m�o7�׉kasnͤ�*�mc����t� r꠸'zli��j״t����t�f"��/qav;^9깓p@f��y2��s������o"r;%kq/�^h̹3�͜d���:u�d��~:��{���u 8��������:lƒ���7�*�{�7���*�o) 2�w�x\q���`�xl���=�to.�fg s���i�$���~��s"hd������l�vn��t�j��a�a�_θh�/f#�3<�y�asd2��c�õ��n��i5,jl~w�jo�r @�ܿ�q�t@����aije��iu�t�σqf��_ a����~����u�~�p�_8n�n�0�{a��;r���^���`37�������d�ht���1� ��7��w���,j�����qk2�9瘓�� &����||r�?��'����;9\؟��>����f��.�[ ��|��=�k�v��~��mn�vk�v-7��37cq��óz��t�:��pkx�q>�����w�?׳�?�#��� �o���c)����a��h=����j��m*�?�9���k�k e�i{c}]���1����~/��b�]�l��l�6�z���, �w�vޟ���/lʼ����?�u�}m����h�@ ڜ�� �o>�^�o� a�[ �(�y)���}�� ץ��� zw�q��yjnk�)����z�þ�h\�v_�ն[glr"�';{��u��,c� ���0�m��l  �sdb�ptsm[r�t���vg>ԓidl��̉�u���\p�쿂��`��sy��q/y�v r�t�k5e?�p�wmޕ_�i)�q�u���w;нv�rj�ux���`���2�ܞ���.��#��2ml�v��:�7 "\>yޕ~=ɸ��^��w�l�9�ܔj8�9����� �x��n` '7��� ��;��t8�y-$���%�q �o���l��e��t�`�<-�w�\a�?��h*�� piao]q��4��,�.���ԩ�fi�{�"��n��-n��-6&憊�ch��58e�n(,; � �s���zl*k�>x�|��`jp@<�����>�^]����o�v*e�a ,n` �/���ގ6�j��u�%z��ִfev*�zm]�.�.f�����2k`��5�����p9[�w7����஭�g��q�1:���� ����b��c辎o��=��^]4�2�vc7o��o�j�� �}m���w��ĉl��u�ڛjӏ�������lan���?��$��>`�)c������x��i�  8_vu����[e�j�^���v�6'���!"t�������̀l�9hq��ed*�u�� ��j�ešb������l���f�~�{]��u���8������ u,����h k�d�x�q�z�e5��e�dt��{���e8�ney�l0����?ҥ&2$bӧ���an=p�_��z �,� �$�)� [�^ٲ���m�ǖ�^8[��{l� 5��z��s!n�nɶ��ۮ�d���gs�� q�*���7ԛt��xnȓ;?b��q���y͝�w��dr�[g���� s�k��um�e�b�ܔ���l�z�9-ux߀o�"o�`ҵ9�#�f��eޯ �b'6�p1���]�����}�y*mld�zg�myܬo86vwn�ma��<���r0x0��>��l�yf�f��h�dr�y��g�zҍ�g&������ۣ09j�n����㷺�,�ѽ�smy�etgin���k�-��a����k9/ =�n�mkkhi�vy��pw�i͖��ҳ�/f��:5�x�yɬ)�g`ț�z�o=߆��mb����h�=��/�;��w-��`�td;s�f�) ��\�v�Œ������v��ĥ��'^?:��x~ ����y����v���c7�7����'�|��ᚸ&� �$��bq�y}�6uڛ2�j��k.�u��1��jf�.�9g��d.�`{�x؜�vۯv��up�v_� ӳҥ�j1�!���>1�x��ˮvfخb��[a��|g����radz�u�eѐ7�n�<�u"�a�8 ���f�q��vo]o��:��u[�^�o�{�⤂sb�;m�i�cn��@�?m65�ʚog�o};�sz_7�d� my q�b�u��=��qra����f�b'y7�e̞fϑl��gn ug����{���dqڋ�^4on��t <�o;*p�-�����=;�� [�3t��mv�,u͏qd59�k��m��継i�j�j���o���3h��8��������v�g��������������=o�pv��ao �)�@�"��d�e� �r( &�@�_�%�))��?p�랞��]������������2 �˵3̣���͝�.o<�4a����*��{)��\��3e���f,*ys�* �,�~�܉c���f��u fc��l/m0��;6b�忇��'��b�i$#g��61� �8��� �)�263��,��о�m��ƺ�j�]ʸ��׬��e��d��z� �h�f���uc#�姓��⾍e�_���c���)�ts���vx��)�_��>������ng �wn^���jy�����g~�;��_ېɣ:��kx ����� 2y���ț=�?�>k��/,��n�9��[wo�ڏxݷ��u|���c�:��amy���\�u�<�>}ě�,t^iwe��m��,w��1ٜam����e��� ˂���ӏkaf9�;�s i��;.�����r����ywb��$13�!��p`ucz�pxݸj����hzi��m�z��e�uۚt����vrl0��z��7\u�,�뭾f�9u��)mɳ�����@o1c�u�(�uxaqn��q�/��y��@��{*�w�n� �9�`\6?� ȇ�!�q�?�����u���,�������wx�`�q��}���qq�5�'̬a���u(��ۘ7 ��@��s�o3�v�& �b���$>o�e3p! �m��h��b(�b]�� xaids(x��l ��s�35om�n�0y�e������q"��i·�z>jʋ� �mhe�"�� g��r��4!,���3��֌f���@%ݳ�i7�<��u�xmd��|d��d�'ǝ����l�|��l�p��i��wc�6�������j�"���m ��r<�l����1��| ˞�&| |/�lq%7u%��#7 /�*����!>tugk2ٖi�x��aa�[�oomo�aq4��ֆ�r�����scq���6�����w�.�t�����޳�s*h�l[���!�[�>{*�6�g�s���g?��8~x�y ;�}<�v3��������`��m�> o�j��ֺ��k��[��� �=vue�����n�.sv}���֫`�a�^�#�4x1tݴơ��p�x?�0y�v}� �g�ej����z�*�ړy��{7���~0z��e��ga��5ܷl3ʷf� ���w;zߞ�r� ,��ƹ��]�q����fw(}n����yu#-�2��`=�3ei���]� $��o��:��绔.�a����u`( mt�@g¾a{��1�ܪ�ׅ �9�x@��z��*w��3��z%�����d�����y�al���o^@�z�{��hs^܅g���_|�����l^�3�\x8��t��@oi��y������g�mx c^md23��,�ʗz�:?�f���`�����q|�����4�]�����@'7��ոm��y���;�w���v��_�{����ߠ����|؍��q�[��4��l��qx���kgi|�]/�fl��p��c�ʄ�6�i3�.�l5��{�@�6�r^���z�,v�$�g7�^a`#ާ6��~��qh�v\w�h�:��q����umv���[9p}kcd�f�t�w���t�����b6�a�jw�wf�ˁ�)_��y���{���w���}����yc%o3 ����wci��ݩ�h��nd.��>��9�����p�f�5*�[�s��e��v�%�k�@?�ͯ>-�����e5�����c��� *�l=�<�]s��oԧ%��1���,���u��z4������2��y ��[x�w� >_�a`�x n�d���el�����ws����}��i�17/�~`�3ugc3� . a���%:o`a�gx�ᾴx*����)gn�� č&��t�fmf��<����k��g��f4e��v���_~�qi�d�֬� ��"��û88�[܄��'^4!�nx�-�5i�9�i�z <�3�/��6�o�z@�sh��y�?�r�z q�t��y4fq�/s�e&�,��߽�6�<�;s�ݻ9f� �ca�y;�ͳ{6���j��j��r�w�6�d�y����)�����'��/����l� ��fи���_h>[�q��/5@}>�)%�r�����4��f:�|�jx��h��o��nl�r��iq�3�s���g=]'j� o��� a�qkj�;�l�����u"��餈˾��q��e�y���l��n�ߏ���ɱ�e�� p�u�����նv���gf��3����m�f��`���1u׹so%�u�ub�e*��j��ˇ����]�a����"rvk�pfȑ��r�v[�<�φ���!#��q;i��4 �ӕ��o��7�״�� r � jp��<�qi������.�xx'��qȥ�/�w�}z���\��ܽ��8�y.qo��]�ԋt?��g�ߏ�ig8��ɀ|⭗r�d�xn"�˱� �sœ]�уன�*��޻{h����w�kg�5!ګ��|]$�h���:ca"�)o�����b}�!� �jx��i�k�v�ok��\b���0�;�\z����63�����q�bj!����hsvi��@��c�('c�\��y��p�����ϩ3��|�֩ th �e|j&�2��yd����� �������x$�h����q��l>�%�2c<�y8���ր yrb����*���o������j�fbm܃=�����k��~xl����8hfa}���yeг�l� ^��)����}d�� ' yhw�ge�!���^��u�kɮԑ�e��'��u�o��b���s~c������%#�x�`(�$�r�t����_�jq[�.֢4�i�� ork��'�����0��/��:�n5� 6t ���k��z����[,�xg�uw/<�$q/�b��i�q��冢�7�th�����s'5 m�medc �0��wd�zξs���~f�� �"�ƭ �lyc�d�^d������x��pn)���/��i/�'��p�b��n���-�c��:b�e�� tyyc����l��ufl*�����u{htcz)4z��_�ݰ�v��h�� uy��6ŧԪ!��( ��su;��{�� p?��;l��o�`�,��і&�v_����5�` �t�4�sa��fam��#>��������3�g���tq��ox�١"�`��k���a�ú�i�5)j!�̓�n���rl>r��6���x�z�f��h�뜵�t���eht{u�k�2vw�p=��z�9��*���s������u��wd�s�,h�)��=p`.�i�j��ɲ9�l�r 1��>�!���1�[�8 ׮j�e< bh�`�mӗ^'��w�hct/�h�����}!��)c�a�cpi{��a���k������yǯ���m���j�ᐞws��^�9�4��{�,�#����慹�������&\�\��x�kƃ(��#`ѱ�#qqb�u�e��z�0��v8n%���ku�}ʭ��"�l&�3hv��i�"}����p^͇�p&k����ԍw�g�%?�ze��^m���z��$ wi�� ��c���x��v����um�� ނ !:�՜�ug4ׇ��� ��j�r��y -�h�p�k6������0""��� �lj��̖3#��c����|6��m :ː�����)�r_��c$p%w�]��܌ 7d2��߾1扚���ұn�;���fn ���_�"a��4 �8�n�[��l�(��͹7�j6w^s�&f@àt���נbd!-���g��i�x �� 1��q%��#fkv=��p�s�wݯ� oɾasէ��\'�ư���*�.eа��{�� ��e?'�f䐷���d��c2!���kd�ї�o1���5 lm��u�տ�å�����\�b�/q�<� rg8b6uq�=����d�0y�ڑ^]�v*u�l�>gl?����6" �šl��k�x��bk2�� �ee��y����\��!);u��}�m�`yw�$��a�s�¶�j(b�ɵ��p�z��r��im�:#� l�{ڥ�uc�a �hi��o u���y2΄"���axeq.�b,r-rk��,��k�.�grլ�"��e$g^���f�'�짾��v�*��<�d�i����|d��#��"��:���-)'�|��?������g��mt@6�ښ��;j_@f��op"0!¿z�����p���\^��wr� xk�ze�wjl�2�[x���8��ǁ�ԝ=kƪm�/4��vkc���r�feo�x���]٫���g {����8��ҡc|����8�rc'��ynbg�ii���q�d��*9u�$4�d9������ ��`���r�[c&'�e٭��k@]pm�o���'<(5/]�����e�w�ya.��ť��,�p4���ub9�{�،��ujo&)��n��[������s�6�1���{����yu�3m�/l�o���y@fm�-�h�f��l\��d�z���-o���lt�z�=��/)�jś ']�����$����ᄆ��nb�m��&f���������'�ٚ .]w� sָ� ��`qw6g��� �q�t.��/t�� uk���ȕ5<��e���4��;d\p�� �t#&r-dyu�f����jӑ��2c�d�d /�m�m��ixo��ۯ��ϼčgs�8c�أ39��|w�wy[����7q�fg����r�������n�{jsk�$pn�;y�ibrw�¨��q@l���*�&m����љ�i�$[��y���7?�v�.ω蹵�k��� ������7c���ě�k�j�r�� ��x��p������@:���4� &iwș�����~�z֦cy7����o>f�㱑�d뜻��`����ټs5������my ��5c��<�/-yy� x��z=r1�����-xp�e���_@q��y����}�m�l��o�e �=��z�{��� o|�g�š�o�z�o�0jl�������w��o�z�fj����n6j<��t:֊�y���g*��|����na6�r��x�s���<��!nݢ[��? ʂ� �&ƞ�dy�����",��s�0�$�7�~�*ys,�(�fc��ĭ��1���̢=��6�gϋ2���#���*�/b��ʼndw ��g~�\l��(�x� ����ơp� ������ƀ ¡ 8^��h��f 9�i��rԟ� 8m"`fӱ����j��b�đei;����,�u�n[������}�� �x��zl�ιv��]��5��-fr��[�����θ\� �&>����~?�"!��:q�)��ֆx^j� abx0u- |r.��y.˽� �ox�vҹo�9���:2���h_� a���r����vt��e6ܧq��ܢb���/�y!4�e<:�&��}���g6�hឺk�r��q%�qp�i'�y�m���êv��$��j�j��?f:����qڰ>ӳ�dv�ʲ�4�k �9$� ��z�f(����v���lз���h���տ҈mpd�ޞ�nzp@o����f��ȅx �cw��w����: , ɓl����mbn� �8� ���b���ܴnr5�\e �8x��s�w8�r�'���ӹ�a.�%�uկ�o,��kת$\�3$��,:�{p�����!�ř�(������ಫ���b���)z5�.��ϛ�ep��e��l�[�{q�fx8/�s&��t����"����#�����y����a��o�77n>��2�cmc�&l�"�al7�{^$�ل�,�5�ҝv9q��13u0�� �<��������:�"��\�r����qo��.-��3s6w�^t��whb<�wm`�)�� ��������wln�s�i�a�0�����.����x��h�n#o�z����� iv�t�!w�n�]ѥ�y�1�c����f�`��u,��� a��;�n�a|��$��h�ͣ� �e�*xhd|>����'y/�߅ ����"x[�k���m�(�]1�\�{�~�b��y 6,7h��b�� �̀��������٣���e�0c�m�ѻ��~���\�b��`�k� ��p����l�i���n äe��0�e;t��ƕa�)��"����p����/-����č�յ �d�=�w����~a�y�o�,����[i#ң4h��moƍ4�;�yʉ��jukhnv�c1�)71�~���ᔭ��r -mb�����]����,/c�]��i5"��`�dps�j et��c/z 1���)��t��y���՟�:�ce?3��x��z~�2^'�1ʂ�7�lp���l�7�=ʚ�tu��f������'uh��� �h ϣ� �ѻ� ��q�e����ގ�-���#~�0o�/��w�]t �����t��e��;�b�%@� u1�q?�"��)d:(4�t "fc�-�(���/~n�ۿ����o�h�}?���cwd�gξ:v���c�~9j�;��ܨ����g�4}�����y�:ҡ�ܷ�����c8��zo��?��wl����[ԅ�f܈��m�hf�w�`/����p����t�]�̄����ѷl^'e��c�{��jo��yt��e�x�w!r�����i�;6b^ ��c�.{��>�u/#��@x������8�x�����"р5�k�� ��b"�~ĉi��� �w���o�a�a[o�5����l�3��9r� ��vm[�w�1�jk���j���َ� '�\g��2x�ҏv�kp.��� u�w�fo'!�� ~�bf��:z�3=��g.j��k\�� /ߥï���wr�fq�oޏ�|� 0����d���7,y�zb�~�ȉ rҿ�pc���\�dۖkmg��ѭ%�c0ϟ��gq����38q��u\-�>r 6�`���l"u{��iq.��=6rhl�jt��'���e)1� �vz�ma�0�3�"jtey�/dq�p�`ns3é��b�)�5�fc��ӡ�}j�w�fޭճ���)��� ~.��@�^ n?���g����6�����6�t�t��b�v �%a��a� f��ͤ��c�5��k�c� �^�}$g��t�e��,bq�'4 k�lt{����s�g"��i�%��j�ko,� g'$v@m�$����p r�pu�̝�z���?�����yk�@�@sp���k�ud\��`5gg�s"��9��n��,e5oˠ��&���(��3),��#�_z�ŕy���^�m�`3v�#��s����{���.z�f1���m&��l���qz�з6������:">tq �~׶ �n����g:�����$wo��xu��n�1.�w a���&<'�����3?�q�!v��l�{i�ֻö�<����a�:o2eh� �a^��_ko�ix��y>��(��tp# �gq�b<$k*��ܤ�<<� ��&*�u��p3� ���e��>ܶ;b�ނ��m��:�^��s ����� �#�u�t�tj���t7v�����b��kr� �x��\�3�������q���� ��ru��r�󕍜[�����f���i��;�u��t���'w縚u��m��f�]ߓ����}*�|�òz�#��i�a����jtc�np��b9t�f��^z;�ō��8ʹ��t�����u�)�j6s3u_���x��p���3�.�(�� ��5��y2�f��s3�?m�;��������n�kqz$��� ���d8�ps�َ�z�tr�#��7�?����0��aփ���b�}�6=|tf7b�~��~�(p#o�={v��@מ�x��}^�n��l��da�\�1�x.�z].ǖ�����–�wr����}b�pn����� �q�����v���*��'4/��5n�_�w�?w^�ڸ܎㩝 .�j)u��^��gy�j�dm5xضɫ6����pm?.z���xx8g��o��9����k�k1il�y�|�7f�k�y��~g�i, j�uki�� �:�_o���4��� dž���3�t�na�܋ 9k2��1�0�a����ɓ��۶��hx�t e�"r��j�vd�澋e�:�8�,�h���ɸǩvci��|�ev��q��)��d:{�ه�ѽ/~l��$fȼ���͇�i����|s�z����c ��_�n��n�r�nj����d'�c��p �{n����x������v�iñ! hܓ��s���v��n.���:�r��s��ߩ�*��i�ϋs�;[ֺ�{�5',b����mg� ���_-����$��b���g� l���z��[�������e_[y�zz*�ty�q�w�&��l-t��' ��]@��y�{��v���j*l� �?@�a��}g�j�� ��x �����g�b�y������{�d��x�_y�>7�f����p'ãk�d[ �sm"�sr�ƺ4� �zm�j�je�����p�r0~�܏�� ���i2{0?����� >�o��m?�,��r�cs��b�~`˦o{������n��9�c�u�;��i.c� ��vm�����l��d�r�)l��41 ������y��:_l0i��ҍ��k�]����lz��bx'``�(�o,�s�r����-t��t�� ����ikp�/ u[�j�7� �> ‹1mo���'�u�[eg�i@<�i���jo��o��q�w�6�-"�²�g�q��;;a���^5� �1��$cg����kbb4v�� l#mkq\d�~ph�/�� ׅ���1�i1��x�>>&1�{n&�w=�'?�����r�,n9����.&����/ܔ�mi�u�4)8w˹�&n�dk~f�47�p��,�b��6e��֮ź�yx|���_���ij�tf�!η��ˌ��7����1;��)z��w�p>ɠ���������vϙ^r��w��i^��x�k�x�ڵ���uy�r�ʹ\;���*6�k v�?.~������͑}s4����5z�6a�u1�ķ����eԭ�f ٺ��kܚ���<��&q���������[��\�nz�:uq��n/l<��3���ز�?f�jd]����d��f y�x��q���y���gd��t�m�l���v�4��g��3u7�ns��ݼ|i�k>u�~i*$"g��'��dtcdg�ĉ��������ƍk��wndպ˄���l��0k�"f�ge%���#:v܇cm����crp#q�"�a=���n���ߔl��%�e�b�q���b�lļ�b���ؔb_��!:mel�b�3��c�����n�牪��# �m?pfyli���┷����>�ϣ9v���*_�]���"*wd_l���?�t_[dpjww�2o����m(�=(�a�m��s���b�a��o�z�hno��k/js�k��a9�,�#�� z.k��`xڦ5zuɯ*����inz���@6?_��^�z��-f� }u�1y��br'aq9�“����3ᬜ�������}y�j�ݾm�qy�_5���:��cf8���}��q�|�g��y��"\5��#�9��t2�pϛ#r��hf��y��8o�"α��s�{ue���ʩ�xd�]���h�/q` � ��"=������l>��x�zu2':z� ϭ��^��r�t��#��qi4�n4|]��a} lg�`bܟ�ݕ���2> ��gt��3�����i��zk�⹗� �d5�]pٶt�2����h���v�x�h�n��t6�\��bwkk6�y���g� ��itc�*��t��r� _��������9a ۋ�y���k�z��abfx.������"��?���n�ωdv%�:�f�l��"e3�(�f��j�������,�f�y�vw, ��mqn\?,�s�l��0i�8'�'(g?�q�o��|ӄ/�����qm���ٚo��&r�l xo��|d�{��`������#`r��t.& 80n<��`���0/����i�ڗm��������?�}�f�ΰ.c%xd���cj��gn�h0n ����x��q<���,`�����q� *���k�ծ0�4ey m�h,nx�]�"|���,��:f�w���j��q�2 s[x��j�s���ia�z*��$�2l%�������̷�d���.%�� �r�sk�t��w:�7�s�\3l�qp0��7��x��a6$\��}lϐ�͂�:a�%;e��a\��u���v�ۨv4����`�@���%=�ԟ��7:�g]ݝr�m��t쓀.d���;� .��>����x 2ˮl��h�u�սggu�d�r�-��ts�0���lh�f9g; �k��|^z/���k��x� =<,�ٿ�f�ǩ���k,�>��n��le2z�mbt�b��-!ݼ� ��`�d�j�z����*�kv)h�u���;�y�_e�қ�k�� fz3.��y.�s�[o�d�b��� c�t��o��uo�e�1��cs � �ծ%-'��ÿ�4o�� ������n��`zv�%c �����=����/�tqe=���q1a/�('�\�ϛb5�/��b���:��t�:q�fbq���c<�w[̧#�jph{�n�8�9x�%�2��vp��r��nk�i �nxԮ���<���c =4wy���"g��-ϫ0�3xe ��n(:��<t�)*w�t;1�(k�������j���i�tfd��` ��%�f��|��n��߷�� �b�qz�5!''����=� �7z '_�-^�� w6b.�#�*�ey9.wtiċ��������/�= c/� �(��^���>~ l�;xh]���~u��f%x�ԗ�� g��k��l�(�i) �.6n4 ��5�iq�֭ ^��d���q�y�{�b��wq��d6ە<�(�8i����fx0&,y,���]�;^gl�r�m vר��t��r�d�%^�k<$��t�dxb���lh�t�l�9<0�uxw �6ӿ������ne�s)�lw"\;�w��:|�9ޠ�'�s}���w ����mūs9}��7�1lt,ր��/�v���t�w���po�ٸ���ό �eń�by ��j��z��<���7[�i�h��ʀ$d#^sy��̥�65�$s-�zy9_�lo֢����� �y�h�ƌvi= z� �vx��m�碠m��[۩����~�4 ��~�ݯ�g�o�j���h쭝? �a�¤o����1������ɜ�"#"��lnaaǹ/ �|>���̋)pc����|�n1g�� !;s�[h�d��n1q�g�� �j8��� 行?���s)��>h8���%r��n$�3�c1�u �*�n��^��xц�u)�j��_��ɸo�a�"�8u ���ο���ju�q�e��n��[�k����m��#�hk'�m�!���)�r'�t���$��[��nm= ��1x��w�lk[m�j�5;���0� ���y&en�%����@p�1��vŧ� �o�l����n mp� ���s=�}��[}���w:�ւ雭&��pt����=�x��k%6��� �`��� &��r�d��g ds7���rkw�|$�}x�v�w���҅`��6&i_�n����(���a�-�%�ѵt:�������d�����dj3��i ��!d�a�n��\��j�f�tny5�c w���"5�� �e.�;�o�b4w� ��3��q� �[@���s�/���˄��c$��c�6 �rle���f���~i��u�'gu����o���8 ����k�3u���\���snf�_�� {�i���eov�^]x��ב����j�l�k4�����e�f�qv��`,����c�e2�"����k�dk��j�]f #q�i�yxg�n�����jdx��� �:d��u�����q��vܽ�*��տ�������3ӓ/ff��i�oq,��?��i?@�v�jo�v�����"�m����|�u��z�z< �hk� �;q���e;c0��_�������ew��-�g�2�s�����v���ݑ�� �[k�{��)j��b������j�ԑ n��1�n���e؝����z�t��n]�pa�b�rjr��(�b�t� uynp�h�� gl,刌o'��dh�ɩ�p���(7�����ҏ�bg��{�������1in:�j�ݳ:��o��qhl)v�md�l�k$�� !y�������i=}�a׎�p�s�rtc������,�ㄿygld�) ��1<ԙ�"�g5fuit�e�j'�~jt5ˁ��>:5;/q6��kt�f��oqwl�2��s!fe��{���{������e��s�{�i��g���n� ���[���*s� ����h{��n-� ��˺� �3�?�za:e\��o.�1���ޥ�x��y���/���m�uꅎ�j��6%�������n��l�@k��,�/��0n��$�zm3� � z�â�|��2��� �f�r>!/~�ܹb��y( 0ύ��ǁ�'�2n�h��{sn1`h��n;��˄o��]�?e=&b;��l'�bnz�|��ĩl/x���e�7�u��o�: n��ls � �j��p��dd�'�fblj�s������la�*\�wy���z��rgų�?^z l�l2dio�lw���c<ɣ \���5i���"^3�r|p�b娪��r^�y�u��lzn�`�ql^�=��i8��� r[w�%@�v���c��.��g �~f��w����)�� {��fd=��k �)btr��?uy� on�i��*!����ʋ�^\kק�ǧ*t\l6�y���z��rzz(l�s��b<���'�{��`�ׇ�!c��|l6����w��n�e�h��9�c'*_bypt �ў�y��? �ö����3� |e#�.��3`���&�b�k����i�hh�e�t"q<{.f�gv�<�*��>��·�h��e,4�f>��3$6�d��),�� i�v� -����y0r��0�����a7jp7�n�i���(��ݺr�fׄ�fq�h����o����d�9p��#�\�f�h�;�gi;a���ͷ��|��r�m�q�0v\�4�ծ�6��>ϧ\�y�yx�5'斠 pa���|ʱ x(ic͹plg����t�2mj������َ(t|n �?��۶ǟ�|��f�ı�ik'�<��[� džk��kf�p�7�s�l����f�o%!�͚�7�du��-�p�.� �.�p�'e�щg����/�.xu�q��n38_uf=�5a(���u�yq9_�<�����p���a�v\u�o��qd����6j۠��u �b؃���g��fl w9hø��m����9{a�� ��'�з"m�%���$�.�8�|�=;{�0���=��a ^c���������[̠cw��z}) 5�-�p���s��[�c��o:�f9.|���l����`��?ex�#�—@��nq�f�u�cm��\��a�ʸzy���\%�u�"� �hi>�ynq�dþ<����ϸ>���[<�ӣk���������o:y��\fu�y�yuye/�*c����c�ye�)r�t�\�ҏ��abmm�qby�a�o`*��7���%��,ĥ"c?tz��v�˙|j`ӎ1��{*)7�ky$t��.���t��\(2uoo��v�<&,?�dx��q j0�����ci�/g� �(%.�� b�� \zsyӻrd�j?��',�m;p���r���ŀ����qo��e&b-t�i�q$�g^"ٌ�~���up=[w��yu�>&p�i;d�\���`���=��jb��t��������ߟl� ����^٭f<�y��d�7�4i�� �`t� ��l�|�̙�wqf�� 3����8�^�d�;���*b8�t�:�5ge0��b���m��!�4��c���r-�j�j��ya�xxa�j c������wa7�w]0wz7я/�{�k���z)/�m[2r���jy�_nc��4py�^, v�ok?�s�^��3mr���a7t�hr�/��~vg2#�/g���?��m�ҫjt�2ə�ʹs��x~⾪֫�d.��1�y�r��fn��(=z4wx�p>" '���-�:�n���x jů�i#3g��r�02��p��xw�a4pxv�ސ�����c�*��d��4#�_�$�]��d(�8���|� '�p@�etf͚즄��r�3^����cߦdߏ���s��u~z����ihgb��8y�~� ��j��u�� ���׾�s���pfg��fş�q_�pa��wt�)wn�op�g�)�u� z����k���c�k�-����������|ν�w�}�<��nuk�asgbbc�i  l��nqq�s.�q;�b0�p����\���#���$6b��}�}�������^���}�^���^�[ymv�-sd��kw �l,�p��kb�6{:�e�ց�x�l�:��@�5�o��'ү.����� vr �z �vd�ɸh� 5 ��"@��v8�\�u��#"�k��1^��ֈ�uq��@��a3�7��z׹�*0odalv�.k �<��nh�b�.a�:5b�f(�#gx7�c�i�"ѧ���6��[�j��&�r-��_��k�o�t.�_{�v��υ�3&g���1#���s�x�iz�p�v_y��3�� ��ȼ�@�g��o�zw[������ m��q��n��s��2�j�fj���c~}t�4���:<�<������-͘�)��#k���=����;$�@f3��yqfߎ mtkam��5q���wv����]{�cu���_���?n�1��ڛ}\@��d�h��b��d}vy�t3x��qy�y��ԙu�_�7lryt���9��c�ƻ)w���h��������,��tjp��h�u#�y� �g��{�4a�������ڋ4śb�(��.n8�-���}�o���qڰ�u�w�&�c qb��|�z�oᅷ��~k�m@n" -���z��b���ә��pxt��a�m� `���#l��n�%&��g��4-i�; *¼l=�w�83y�q�}� _������‹!���pu����[��\r�l��q�:�g{��# g|����yl?��bq6�>�'ii� 9������oe*jv�hioo���� o�\h՘[�g����2���0����x�i*=�@��7��kyq]ӭަd��1 h��yqt���̯־y�2�3��sd�u)��;wy8�{�>�=���0n����au^u�x����y�[��~ɠƚњ��d�v�g -1�,��kx��ron�g%s=�o��^�i,[�f ����.��u��$����<�^l���0t�w�gm��$�v�wne��{�� �����*3x!�d�u��s�#qp:{e��;2�υ���v��©se�i�7���c �#�\q����vc�� �����n l�h�{jw���(�=��$_�~�z��ut-��@�4��;�ߧ�f�$��o�0m7"iw'�9��"!e��3����%f�ko��7���w���vu����;ýst�s�?4=5�;�����_�wo�վ]mv�䧋�[x]���'i\#^�x�b�n�<�p;� �p�e��g]��gr�� ��i6���m)k!e{�5�g����m�ۈu��m��*:��*d^�jv}���e�ci��g�m�lr�5��4���sl4#�s������֯u��[��ڷ�.�i?��j�� p��v �o��mdz��mmd�c`i�ed~��ϰ9şwm9�weu!���cn�|�y��1i��"|9r|��%���(��u�����w�7#7��ˮ�j2;��ԝf5�~������z�&lj"o3�vqx�p��~m�x� ��˂e�ت��7 ��@#�=#(6��i�.$�ax�z��_�~���ry,e��e��>����5�hw]w����fi�y����kp:c�y�ŋ�����v� �˕]@��m��n�'�ny��s��ݯ�o��ű��k�swzp�gsљu}��*-�%c�d��r���j�4meokl�����j��uʆ��%��¾��\��.���2{�_��%�\�������֞���va��z��������o�uߦcnxl�#�wq)f*��t�#pe�n&=b(��*j�r��w�%�i�\p�d���ļ�&�x]��e��@�� ���q͐�b΃4|��i��cb�ħ;�_�$���m ��ko�r�/ �vmv�s�o��m�y��b�9�6qv��v�dl�`�-i�$��aϡ��ːq`:a ~�,i�s')d������5�_y��-��d�/t(������<���z,�_��*\q��qb�q��֚��'d�_�( �ˉs��8��b��wa��1�[����������������z�� &.��������� �s�mӯ�� ��uv�%vgrꧏ�93�t| �a��!����"��κ�<��ttc��y�$�����s����v3� ��>��n޷,��w�ɛ ��6���z/�]��z;��� c�:�c�'�%x1#�ra�ljt�f�z���>�ul��(`�y�c� � ?�c�s͉�t�am��"<{��w����ymx ������������n������.u�o5уv���@v���i��u�edn�z >�|f�g}[o_��(��z�ra(�s6bvx�ҳ1��7��q�i��礊䥧5a��4#�%q6����xw.heaw=i�����z�=��o#���~�������f�7�nߪ΍wkg�sy'�a�x�=�r�91j��7�ut`p3�5�p[μ^i"�䛸q�� (cma�ڡf«�[�c]�*d9zed��ed�>8��īy�-/ee[^a��g oy���ťa���"��8ms�)���dn��w�v���u��/&���<��k�4��`��r��y�ߩj����9���!?3}7>jg3ݦ2�ge#o�wx� s(� ����e#�ek�تk�%�� �}c8������˩h�趥�i1�w`i�|��x��җ�%��e��(�q�2ve���'�j�8�*�si���]4gi�i�xnn/&s�i��t�&�� v;�<��6����vʱ���w���te/���r�%������;��'�#����w(�l?���e�.۩��,��͂���v@�3g‹:���f�#1?f #ϵ��s��  x��͡l�%k�4�������//�����-h��h �$365s�����m���0i�n��$7h�)�z?����y�w��v���<��r9xԣ~�z�����znp�z�?�>/xf�9>j�^'��̤b �*�l��z�$ij%�p�ބ�1q_����#�h��~��'g��m�e=�c究�5���ϳ�ik���x{�g���|����s���1',}��f����v8��6� �i �1w��9��'��ڻ���"��:�f��xw��^#$��~<<�#�>�x�e�������: ku��g_�5j;s i�߸��o�虄���_@���nb�����y����~�?� ��6�����k&��d?��-x6op4������w�._[{=��>r�� w�`��@����~�f&w�n#pva�y��� �u >��p8��y�����e��j�kx>ƹ����������<�g/xl����߫�$��� f��*z��-��]u�5&��f�@ȴ\�t��v��u&�(��p*��� e�$咮e^u�ۨ‹cf��kb�!9xx) /���m=�� �jip�&����z��;?o\��@����&x��yd��l��6%z�矢�}p3î�j�x�%���ׂ,��wc^/�_��0oeekk�����l��]]���?b��k:�$=:�$�h�×�i��; 8�������er6�k�}��� e�t��f��,�t���n/�e�t��_��3��d(��&�� ڨ\ �u'8�>=��� �g7�8���5��sث�ȭ�a���7 ��� ӭfw��6omt�d���f�*p�j���d�����_t�x�������qh�����g���_@g����'��m�)��8��hh�9��!��we;�x ki�z��q� <����vq�0�y�%į�n��>�w�@� 2 �qe��"j�0a��w�jn�"�*�ӭ�e�v��[.����>w{ہ�l��s�pty������ ����x�e��i;�{�����r�b �ow �`h�%ѱl��w��� �q=h7� i�)_)�;�^u���gp�vs�<�������ft��#��m(n�s������㽣\���;��'ndoz��r99�$tz9�����e^g���y6_ �=�^f�ԙ�=��4����[w�]o���ͳh��6$s��ve�v��t]j�p���gu�'�ma�-=÷mo��3���a>���~��q�;�7���}&zq�j8�9��g������k�ngz�k��{aف��0����jӱ� y;x q,�p��h��h"�����l��ӵ�$� ��"�{��� <��ʦ��{6j�jvu���=����;�=r01���a��l��sx��675��,̍;u��ȗ�_#���l���h��y�r��{��� v̢�_��n��֞��h�i� ~%v����u��=x��캹����&��r��ȫ ����z�m��"����~f�c�� ��t�a��rf�1p�0ќ�����u����d ؏n����;j/���dc�d��0`"��7 �jw���ro ᰺��n�th��y�?1tb԰k�pf�qz�����ste������ ��y��`�5bsapvg ����*� v8g�g%z cc�ny�宸'�*�����t,ks*��7&�h���� @6�`�d f���g&�k ��p����s�x��� vn�[e !��́==n���<��lv��z5�{�|9z �����u��ӝdu�|@�\�͎w����^l,����5�m-��gby0��3-�����!m8ty�� �j��4�9��i m�([��)����0���8@znj)du�}f�--θqח^�k��nqm�*!41��mmb�g,�bz_̯�,܂ �,x䏄�*�jw� �o&��f�layw7�[�|���3i�f�u%����bn�鐔r����38�wcǻ!����u��*�ep���vʐ>�i��gj c8*�� x���o ���"�[u�8ijع�:,d��n(%�-���r�c�q��1 饧utz`��@$���:�|j2a<|i �q���7d�s�%ѝ�~�n�ˎ�8u�d�t��쎂-���!���}�v���?� �n��j����{�c�egʃ�vf�djpz���l��:�/w�f�\��'�ߞ��7ux�i��\����hm��㾠r�m�z@��s�γ���q���gasm4�[=`��(�ݦ�[��/��w*&�2��:ުz������@{2 �k{���`et������hh޺� � �� �"c�� "l�~xų���j�t|�[�bl���0y�l &l�j�m�\� �)����ֲ�a_?g�;pc��agmjq��l,"��� `����9�&^l���������g���gkk������5t����������g�9����;x%v~k��6�;᥾e���������4��u�н6}��m�f.t��n�&a�װpǩ�bg��-hŠ*4uҷy#/��:ɉ����l�i��g�t����ϫc�̮z��g^�ko�x� ���ƒi�l��8!8�s��"����2슐�e2�3�^6�c\]���o�ζ�?���"��,�ی ��r..� 2���m7�bm�^ˁ��f��k�am��29e���cnn����yq{at|ąt�c��;w�t���dǒ26��5p��"��db��m��p�cadto�?ƾ4���:�}���v���};���x����3cr�rd9"i��ds��5֮*y��ؖk�e�kj�u*eٲ���j�$k��*;)�ri%v��� q~&��{x� e�5 g��o�>[��}k5n>´�ܐ�~�j�le)n[�rl�z�j��_���y��y�#x�պr�fuyp� ��c�x 9[�s����َ�d�r|�tߗ���̐��� }j�9k�; ��s' v���qft�pw�����2�if��l�wt��xʬ��!/���rr� b.ou=��]&�����n}��)��c�̻�y������%��çm j*��sw8z���x��ai�t9�ce���he��t;�@h�#c�}�a��rb; qyp���q�v��k^ �e�j�$�:٩���]h2���� v;��/���~g��b%�r��ۇ�j�n��0~���^�r��!��!���9���k5ٶ��:8����/ȭ�c'~?��j��6�� ��_f{�3 a�����敶j��-���.*a�:y�3��b��i�, b$��{g|��w�2d@*t�f�j��2���,l�n� �6����x� ?�s���'�o>����jj!}f#��t�m�|?� yx��t��еws�܈1����g��s{�n�p �pw�=�!e^xi?������b�m�`^��4\�w�z����icmd ���"��i6*�;�봒�u��>�ù�c\�(ꎀm͖���k�&���|z25�[�?�������6������ }��|�{��m�� �fh�����������[��.;��}��à���[�j;.k�����%�ܡ��x���i��?,y6�αw�r���ѷ��?�r��?�}� l%x y�����ٔ��3azn�jld��ѝ�n��5�����4��1���i�ҧ-���c�$o1qu�� j��\w���=gu���)��q���9ت����s!o��=@��hٞ�!�/�;b����n��^�j|?j�j�x �klb'��¼@0����^�ѿm8$_�.$�(�&f"��j\~45�d�ϝ�yqҁ��o�a0�bh]i^ydkbfe ^h!�qԃ�r8���,=�`�'6�vlu�f�y�#�����9n!~�lz��lp�^ ���a�lj�q;5rєz� b��w�h��п�xnȃ��w��e)�r]j�gכ��p=y�:���� ar‚��ku���x������~-u��^[�d�i�ev��ؔ5��nvv��}��?9��~�.�wck8��y2\)w9�dv��3�`%��:^��$� ��p��f�u�>���ݻyp)���p��^ �a���k8����p�����/$�rj��n9���f��o`�{�i�^�;�>8��qa�w���.\u�t��^��\�okfs������clrj >s�>1�l,�8��s������ł�xpǃe.��� ,an��di� ޒbg- ��b� � �b��n��/��� h���v�%i�v��'$��g�0����i��փ3�a �a�����=cr�������q��ܙ��^�w����<�x��u��[�dr'e>��6p���w�0��7���ޑ��_ ����:9w����j[����c_�����ĭ��$� �hsa�fh5��b-��eä^�����n��v��kۃ'm5�m�lc��� =3��$�}��{a�3x>c�m����� ����s�\8e�8�v�a��v}�1x���0�*� p� l��dzy:뽚�1d-1�p۝x��s�g�9�s�3��=�,ۚ�y 2�g���܇_���5��z$���b���������c�.��f��np�҃���gk�v�eew8$���]�g�c��dy�e�nz��~�5 �y��-,��k�9�'#i����sfg) rn�/yy^�y���3rl=u\~^���?&x�q�kv�#�n�n.b�y$ı�a/��b��u�/$����kp�n�w��<�(x&@��x��2�u��t1 ,��}�q�e2퉱������6�q,�?�eԭiv5��o^w�w�( �}�ccʃz��%�ţ�`�*��b�e|ɿn���ɪ��*��c�]�dw���$�����k�*����g�cd�i��!|_����[�}��j�ӡ��ֆ��qk,c��v��տf�i�7v��� ���kya��m�g�t#g*��} ψ2�\�ˤı���ø!9:�gae�\�k���-��f/w�k ݡ��dc�f֨v ��r��'����ڕ��twon��_l��>�lf���cd\}���w@&���a�dپ����zt�p %� �<�� �ҍ�8� ����ƻ�y�ȑ�� x�\n-�h��ֵ^v�oh}w~�6ޅ�嘴���k�a2\�mͽ�t�֐,vt9q�cь��gig`_�4ws/ߝ���"��mڻv}`�:x�q}x���8#��}2t�>�vwc* �3�*����q��'oz� vq�f��� y��{ņs7����"�ہ�[~t2��$�������f��cx��)���e�ѷ������xb���u�j�_��u�}n�~�_o�e�.��ls6a�f�4t��l �e�/y�� ���b�8 6����ܶ��?&�c��ert��x\l����n6���4 �h��� rf<0@ |�}���n�h�����vu�:_m���bf� b (k�y��!��7��ʯf�du�=�xi|�de��;��q�_yd$n��xc���k�t�`ŕg�2�x�{�~k���n�ivzm�pl7�g&&mq]��-5�*g�5����p�v��l��z��u�����1�6��qpwp� p�s{����� ��f����@8�� �s�~o��&�"xamjaig,��w˝�~̩>9�jπ1��"]��&ҕ �3�"n%_�!��5�/7m|~h��u3�k�/�����8˴q_��{m��n���g�>}��m���s�fb�w��}?n�v��$�v�z����b���6j���#ga�l€.�w��e�s��l�i�l�.8z�mdb0�'{�ݦ~���s�y� q���j�coj�g5j&����:u��at���g�m��r�0��ķj��6g��y��{i"��a�/��f�,���݅�鴖���vw!��=�[�a���y�_�9t���\�cmbz>�풟��dh���٪q�v�t�hp� ������z��� �ke���1i��2�s��^utph��0v]�ň���p����c���:q5a�s��,���>7o�=���*g��ƍ�� ���g�qk�m��q���;�qx䈫������x���,��r79�m"��������ݢ��v�b>�&���z�@?�t!�/i�-n������ کn`�ex!&c̴�/:�彪e��d��o�h]���pbv�o{��cml��w���������ο�� � ����0*/'�"k�xe8 z9 q wzh�^���qa�>�3; y�y��?��s�@ 5���ަo�{j ]�����ibv��5��<���v>�%�e�ox�{6�d����,o�ޒ���vj�v�fv>���w�>�ݡg�����ez̟�~ �ǹft�f��b*�������-������j2߲ ��n� h��u2���j����n��<��:��.�r�-z�53�t�a™�-�aq�������e=�fj����� �b2���[�1m���b�x���gud�d{�vn�عs8(���ׯw!��u�y-��섌���–ak"/�� sן �f���&�! ]�wӡ�]ʋ�}�fǿ^��lv>q:� ?�t&r#2�����������3��baf~�m�ya\n&�c�q:�tc҆��n٭gs:�����������0� ���[�xk�b�284qos�,_v�|kpm���q��x��ÿ��7c�9� �y��ḗ��r���8�z���kzݪ0a��x�xһdqu�x���l&���vs�5[�-��7s��$qx<|ձ؄c��-ې�y� '�p}��u�ڲcvn��6q�sh?xѷ�%_e1�x�e�j������ʶ?�n�6��j��u�➻dh����z@��n('_���'y�z՘4��w��)d�d�,ծ�ȉ� m�遴l��dj^ 0*jm��,bo����w���� �xzrօ����<�k��ar�~��f'�`���3�1�������;� y�b��w� $��㠀��ld_����q@�g�}'�d�e��0\(�!;���3o�բ�_ގu�ə�� ��z�� zx����&�.��7p�c�m������.:y���wd8�b@>u�(87��~z��0h� ���<�ԇ����l!�<3��8�o��j9[ 8 �8x �ro}���� . �q�14���)zʨ姃�z �۰3�m<0yv�}��.���ߪҟ{� �>�_s�o�l7�`�2���ȵо/��í������<��;wv�ry�� a;�yy#�f�7�|�7������_.����`�]�h�j�g!��t�o�fm�*0/pk4��z��|u�2�>����p�trł���w�u�� �ط�ղ�x�,�5_��j7�.]<�{�fjk�۶� ����g�� ' �tn���g�w3�����5�(���9뙎�)��m^)�@ �fz�� �/�"�@)\��k�sؓ6>,c>��atlm�z�iܠ� o_�l8��0���� ���g�ӭ�^��k�' \��y��v����b�0���l�x��ep���ҳ��ו[�� l�at��.�ٺ��;�u}_&t6�s6o��f|��wmfl��zw ͱ�b��|�[��� ׄ���<dip��wx�\yo�~�}�,_�в�^|i>�����ꇫ�r�bs{n��泎�iklx���-�s��z��rwwʛv[�t�莠7�bz��^v�^ {�q!,iv�<�ko֣��}g����&|����������r�po�u����.�^��������>h�7\�;yy��߳�t��iv�׋ &�.',:s�%;�����ݣiŷ��ncn[*�������(�ޱ�1����e����a�h��<��fu�:��(��g�a�w�q��id�rxm�}�v�1tdj;�y!�o�7g���;�ة� ����ux�usd���wj�;σ���үdģz/1�� ��'�bi�i¤ }�e��}��`�r�pk((�s��n���rk�d�� � 3��epr8�#�����n��q�}���}a��� z�e��unf�jޏ6�/�w�r$n�i� ���{vm^x�'[��f������o�2�!`��\o q�rp����u�$�7*q]� ���tډ�%]��ٳۊ�*�k�8��o�0 �&��6/y(��f��ԏr����b�yk��|��� :���1�7m��]vn\ob�,��p��/�5�y���f� �귺j\݋��d�gy��0#�٪��o���q��bb��!�p���5my��wgӥ�e��w��_?� 7�e�)�����]�>䋡��q�/\��g��l2x�4��p�;~��l*j���c�!e�1�u&z��$�^�[4�)g m�|ꩧ"i�z}�|1g��a���_���l���e�y�>�h��ux�l6�*d�bj)`;u1$��l�b��w6�ʓ�q��j����d�/dv���t�2�;���`k:�~�i^d!� zݮ02� ��=����:�����i[u� �sb�[>�����jκ՝|�*����ՙ�a�.�ԏ���i�ąp:�wg�<]�y�wd��p�i�k��:��9u?8up��# v�*z���*:/�u���b�*d�a �aq�d���� �ĵli���x�!3�y^� �c?ڋ��q  v�?�mp�*^�ir�q��'���$��s�l<��_� ~����lg��th���ӑiưo����<>�~�4�{z_jc?�ط ":a���2f&1u�`l�j����s���e �si���~]�.p�"���8�����r:��2h��5h���� ���� ��������z��juc�y'&�n�t��c& ϣ/ z�d���~�1�s�g�ȋ�`�� *��j;elk��=5��ѭ����(���l�d �p>q� |`�f�h���҇��\t�l����%��œ������|��rh�7��ç���<ɱ�����}��� ���.� �v%d�n��� ��]d�)��])=� p��7� da��g�5$�np�k� ��bͷt���*�w�b�ƒ�xqen���=.��պ���f�n]��)��k�y�ߞ��qc>��d��d�l[�m[rd8_�h���v�kc�j��v�4��n�|%h�� h��pa���s\��´�cx�hz��^�r��q�#`��fo������lh}ؐ��ϥcc)��i�[�_ã�dƣ�!{)���?�[y�k�o���% �� �->��m����z��y��f9ehӏ�^��n��>��쬏c����ϗ�y��e^ �bb�����h�j��8�8i,ȵ �]!����� f�q|�m�@8�̃�k�{�k��7ʺş�,�y�s_n��v0����q ����_�����f����8��^9k�����ݜw� �r�4��h���s�t�2��0��`"�v�of.u]���(y��(k|�kr���>ޡo��n�͎�>]#�g����ȗ�(g��f\x�� tl��|�����"y�[,x�t��r��x��ኑl����x�9��e�1b�sb;��<�y��27�f�1���`������c>�{=e[z�kg՞��rgk\�w��>���,���;e�vnw*4�t`�އ��ջ�m2���]��wp����d呬��-[��i?���qd�&�>0ݏ�)6 ���s�n��d��z���� g�~� gxg�f�!���� ������n�w1yg,��gw�t�t/�c�r_p�oc� ^4���l��u� i��g$��:9 :��'���q��iiό⯴:v���n� un�`���h�*�2�8�m��lw��%���w���a b6��=բ�(�k��^�u�m��c'��zͧ�zu�����ӛ&{�r_"�y ǝ7?�c��� ,j(h}<46�j�3��a��=gyc`��擆�ҵ���1���->ae��:>��򱅌�a-�mro��$pd��=ek� ��`�)�tb:�!t u�tq�z��_!�b�n�cv3��$qe&�^-{��s=��� �����y�*7�#}���;8_ ���k߮�de�]��k����f�ξ4ʒ�:�efffdƒ�{�}���^uu�u�wo����l�l�>� �0���l!1�ah � ��� ,@ !f:�y��h �b�h��g뇵ai��_|#3_ի��w�uuww�ɸ���޸��m �h���윸���� �� y�]q�y= ��e/.-vmtg��{�my �x��sf�v ���^i̅�����j*�ҏ����z���t�p�:j�����-!q�!x���#�n����c;!z3h��f�);��בr�5:��v�o#�y�,����� �g��p���8~��� %%�)��gpq6sz �ul�ĵv����n��e�`��;�j�o�o��oq�w��kut�̤3�ul�z�<�*��5t���i��r�� ���x� �,6�;� �@��0{0���\/m��d% `��j_����x���zh�%� k�s5�b�8�~[��&mo�p��i�ms<���9g����h?��6 lc���8���~�p�� ��b&��v����5u�w�\27�qտ�w�4&)����1e}�x����Š\{�=��� �`�2�a:���<�b 1�*� �q�c� �y���2��8�_ʇ:��w���[�n���c/��f(g���dٿd��!�y;җ9d�p6n����y�rԭ<:'���v ��nw�'*����m���#�����[�qgʑa��ou׆�x�z�wɿ��b��܉�≱(:�!�w�uvxw; 1 �s��l�l��kod=���x���1#�8_kg����y�w����u���w�˚�ޚ7׸wx�:����b�rq q7m(���6dx� ґ�������@���;-��n�s��:�\s� ���ȑ z-6�=������՞ەѣ��_��o�^�7?,0 &!�gcz�{��s�/���v���2�[z�ݱ����u3�^����ms�<�;y�~�ڹa��>�n[����v��4�x���x��|���k���ǹ������ i�p�k��1kg��uwy�ń%�#�y�`-�=`�i��bg;k�v��������t!m�������3˵'���b��"�𨱕�_�o@�@d[�2zķ5% z��z�yl�� �,?�r���rژt ?:�ԡ������8w� ӭ�l� psh��@��n���q�$�*����ãh'�z9ypeg^<�� �%v{}�_c�)m���]�lm0�1o�����=8��_�s��kw���`g�qz�k777���i�"�{ z:25do���m��v@��a� �nuk�����a�6 �7k�*�����d�y�{�q&�)%��(�3�m�}�wnږ^��<�b=e���q���-q�,o!���o(�a'���cd�{kt�����|��p���u\�q���3r��p>j�<0f�9��8!� �ٜ��� ��܅8x���f���nх֯��h�b���e�������d��]�������a\6���n���3�h�.g��0eh�9��__6�����n�um�%��ܾ[i�w��v�uo�(n%��#��h��'���.�'n���i��kzl {�������ߺ��z<.�j9}���a?o�|{ý�����ż�9d\������7��<���ql��-�t5a�7�q��w��s���(#�����e�6�!nc⍣d���0�7�;�h�^9=��g1�zpx�p�εz����oˌ��y?��?����|'(��yx��lg7|_4{���ٍ�ml����k:�cc��nn�kn>�l�� � nf�i��i�5���:mutz���{���5��f�v�k��}?o0�v�h�d�����㞽l3�8#���ƞ�� ;r�g�-���u��u?���� �1��-���7��m� o21��]����oq�tq�� �h׌�ʍ{h��n<�(�oa�ɂp=�� �0~yf���������f��; ���:dk�v���g�vq9w�����)�s'd�h��)��1��a`z�7�cܣ���r.�����ŷ�y� �� ڷ��p��7agq�3>��v�v-*����!����[��˕|it���t޸�w��^�i�=��v_곌-�`)u�>�| ��1'�u�lo|��]>�vniw{2 ���)ts�x��b�km���'��n�:ԝ���o_ �`a}s��j����]� d9&�y��<��j}���i,��o�ת��?�}:9�i{ң�wwa����c��l����qli,��2�- �l=����v��e��-�����w>p����sb�9�1��u�<��ul�l����ek�h<*��ᶟpb�>�ѩԋf$� [vy��v�'�%o�6 �o�h�dx0;pҳ��� �l���ݢ�6� n��͇(wɝ��]���t���}ٟ3�_ ����j����vp�]�oil��#ٵxg��]��b��/a����}�kq�f�f��=�;�@�oq� ��yi���쏻6��e�q/�>�p�=`h}]m���o�����|��pͼ��r��(�_�k����r`��a��q>b � w��?�q�ޅh�k7�mq5l?n�{y���^̭�ru�α�&�i9o���-sn �v�&x��_�ށ� �-�%-� ���p%��ij��vp !z�[�*8�^��m]0=ol��ғaqf��f��s����j�y�g��"z]�:���/���b�幾��4ľ��w�<5�~�ȴ)�g�g%w?��?����ő�_�f?:�~ -���u��5#����,碬�ʋ|��vs�4ee ck�(c��[e��e"�ul'��n���� p��zz���������n�~^�e z�5:��;̝®%�vphk��s�1d<곽0�簗�-ϛ����t����x��~��j� j�.z�8�p�c�s�e*� ����;�>���isa~�zas�8z:�w���s��w)��/iɣ.��'���m�s��il�3�)�%��!jt�]��y�2�'��%f������ ��gm ���f�^3.���!��=��â�'b'p�4�ѳ�qk坊�/����od�ݶ�k��c�~��r�o�b��w�l�ȟ�$�#so�*�,���� fk�uч8_�0g`���e��d[�ig�y��w�z^��g)o�cw��j��p�u��zi�~"���j�%8ⅺ�d�� ��3<��"�a&]�l�7ၻha[���� ��� �,����/����7��gp���>j�3gp���my������]j&�y�_���r�?��&�{���h�'h l���y�p!�l�g`׆"8 �"�#$��*�c'bma��؄r w��)�`�$y�u����1e��v�ܾ�_g������t'�"���a��p������*�q����ra;\ۏz�p�$�a� _� �,x��d~j��5f>���rl��|j�\o�����b�i���qn�l�2�b�(as�ԗg��u�o�ǫ�?l��d��.g-ayeҿ�������z#a�?����v�����i�j�r^�m�st��&�ʡ���_��k�h]��!�q�@�i8�@%�i c��c�v�,� ��m�]�����g\�%e �n� ��q���gq�|���5��!$|¯wg0��g�y�z��إ=�����ʀ����k9�"����։*����*�æ��.�î����%���a���9�t:-��� �'�fjs�28l�5����n����ŗ'g�tp�^��6�e�yza��8w9�e�����q��o �!;�gi��&~�q�l�(n@� ��{|��ڪ�y���[�`����sw�7�>jn�s�3���'�;'! � �n���@ӧ�~`5d�p��'%�@w4�ɗ�in���#����_�z���ҋɂ���~ԋ��4�|�ʱ��e*�x���|�ӹ�ԍd���/�vvs`��]d��z��t\���wx�ׯ����8q݂��d�uyy�r�o�o�p#�yn ۓw�֡ҭ�{�}{�� ��8އqj��g4jlz`�|��ק�p�[���i��h3��yp� �iѭҙ�����^s5��8����l���|��y< r~3��k�e��'�y��mn.�ư�z����ƌ�3ҳ:̳a�pdw� ]nۈt6�o4ʩ?^a� ��c�o2��aub3p���k�$�=xx����oy;��� '�7�h�ḃ�;a�xgr�ċ4�ݸ���&j�郒;��֞]_��w?x���xa||�܉�g��g��ol܇���=e���s�q��6_ء����[���=��뺑�0q!l�����m̂�^ͯxy��y�}p����,-9��1xx2'��� f�����{1$:�=f��tx�& ��_�xj{������qy���-��1���_��5�w���nl=��ry����]�ۇ�i����ֱ���0)��oa�f}�@,�xۃ��:qva�_�1{n�.���&�?/� �e���< �vh%�_�c91��#g���\e��w��2�q��/�����*|���g�f�l9�;f0�;k.�#w^e�3�u���x>ruŠ)�������a !d�^mw���qm���*gi���3����k�;v���x5����ϸ���ńj��^����$��$�o�p�t=3�*il�ɪ��:���j���kk1��݀��m�d��sa$� i�rua���w!�l��躹)����ib�g�����ӌ�zmna1tu��{�[��g[�$�r41htp9as�1�xθ:�p:=��0��ȳ�]� ���z��2ҍö.6e��y�ix��ke��_v�n"��p���� ����shvt1 ��ؕ�i�)y���v�yo�����fkp2&�|~��tҍo��p�&{������d�*�z�����y64ix��n7(>�s��:|�� �z)��o͑_����t:][yy:�me�| y�$đd��.u� ��xeq��bdf; �ё{�-}ìb�u�k���b"��h��-�;���z�n�il�23tup���x�أ�xd�5�����.>*��tb�{���w7.vh���ϟ b�c�]��k-'���c�n�ypu��䰘yv���n�}�ň�ғdu�b���x ��'-.��ĉ�y>k$g��ih�,�� �_ d���*�z��_�db0e m6�g���]o[ah�w�-��w,�=o��ձ:ohmi��b���b�fח[ǣ�g3]�r���vns�o&�� ���[`�3��qcrp@g*g�o�⛮� \�o�# �b%,�_7 -��z��t�i#ی\c� }� ̌ͼ��d��my q�k�`�t�z���x�*vaغ@�m�mo�u2찙,d8 ��-q�pr�� 4s!fz�e��"��w��xu�v��;���d�*�p^i��oʛ�//��i����4�dh��҄/�����>2���p�v�d��3f& c��u��h�����0p8߸�l��`��٢���b0r�.� �=?� ��e�\֗:����� ����7����/�54<�o֞/�ګ �s�n�;�����$�e���������'��ȓ��w�ͬ�1���>�u�ո����r�$�i:m6�tg��e֦���b4���һ_1����q -k*ɨ$h1����l "�v$�s��me�m�=� ����� {y��:k������j��hao�`�q�j�~�;����>x�zz��޿ =<tn n���vt�l���v�v�,i6yx�(-��w����=�v3�¤�8z��iw�����u�f��1���d�0`6�$v�3���q�z���tq91����g��/z���g9��]�6|���\һz�����t�i�{n�t�n�˙\8=������ڬ�z�g�����qyi!n�4y2��o��ar~����)�$~��r�%���d1��z� ��g��!�s"�u룦!��ȇ�e�}w<ӄ h�d/x�t�dƌb��8��u�}��x���w����ɩs�]���u��&al y;�]��c����q.�n�pl͜����l&��5����x�#���ƿd������ي��{;:��fb{j�i ��op��.�֣c�?b��[�f�k�h����t*)u�eǔi�o��4���u�z;��č�cͨ��18*�=k���{%_�!�d�zvm`�b��zl��%��ob�vw�ke�myn�d�����d&s�e��vwv0k8l-���hr&�a� vti�f v ��`r��"�x�rd��~�}�p���2�r/�tu�� / -�g��|��.>cv�ӟb�w~����h=�0|���?8�7n~ �lxi��f��אή�х{��'r��_��絯� ���?�a���c�ql������iq~fn9��wn)���9xx53�n'�s v�)�e��[h�ޗs���fj^qa��/������� �f�~������w��d~fza�wp�k���a€l抢�����w\v���=��ߣ�5̕}��̙b�i���s�0���qʪ�|e�o �������k{�������hg-��;�-�i�e�o-x�v�$����" z����(��2o)8��y �m��kd��q&rz�` /�nyf��n���eͣ>r�^sxt��^��zg�r|����>d�.br 48�79r~?�%��v�aza��&eeݼ�|������6%�r�����fyo� x�92�:��:}��*8*���x� 8i��o�3�u}�^e���p��q.xk��v7�u�q�v톔ch���a $��j�������;�-�fe urڰea7 �v�~d��:��(v�㼏�q�y2�����6�e8��n}n�����������w���g̝�y��c�5zژἳ��w�����vo�����r�z�|`����ƌ��l�y{��r�͛��]&�r���d�ȁh]~>�!m�`������x�%�q�c������>��b������hb�\�n�j��au�48��#r-/6,֧qt�=�����j-k.����2ބӱ���=��1�5�e6&���i�g����ςx�n{}�-h4�������y� !���n�=���[��<�nn��ݡ{���/�f�d� 1�����t@����p�6_h�5h��r�s��u�d]�%�����k��5���h��kb}yd�z6��t$��]i谲���newس�{n�1�7e9�[�9�ƭ*l�}mi����za)om'!/��o����r��)e���|p� ��}������5:{u)��z��@b���׫t���ƨm���o-���<ҷsr�o���;�g�j;!�s����m~� �k�ۼܼ�m���͍���.�����v����je��k?�������~�2ҷ�"��q�w���� �i���f��o�볳�b����7�ٵn���t�ݓ���6:cξc��r;�a�6���7��~]h]���~�o�y㷹�x-�w�����r���uy��s�9�!���>�r�?v�s$׀����!e�q�?kg���s�rl�u�g��j� �s�t�@"�[�uj'���>n�u�����.y�l�����k]�sg�����/���, ��f� #]�q�ݼk;/cha�������γvjy���ֺk��a���s�vik��/'d��&k�1����^.�����q�g�;r���m���i�� �a���5� ��a�1}��*�7�ɰ v*�7ϸ '�wjtڐ8�ojl~�6w���� ����]a�������l���,��u$�k�k�>�:�5� �vw�.$���*g���96�a��~������s�m���px��z��؝>��e�g��f���ny��n���m��u=�^�g8cd��~wtg�~�� :�mwm�6�6w_ ��{�ͻ����.z� �j2���ƍ��ot��j�m8v�d p� �s���i�� ��@b;���ei�y�.�-p6�҄��l]`n�"��r���09�q~�}�ѵ\ڴj�4g>4�eu|l��n�p`��$1�9�!a�r��p�>��b��m�af�����j�� ����=�p,��t =,�t��u���ég޽��f���e�o��[���;�����.�}a=h�h�w|1k�,x���xk�4^�u�/-���dyow�g��|�~�,��ݞy�����z�?�n��\�����o� ���jy�u�����s���ڽ���f�7�x�>/��cv [����|�_�|�����ڽ�雋�y�ap�7f�[��6 7��u�ެp���xs���m���&y��*��&ޖ��*��� w�:.y|�t�����k�ޝ����c�թ��<�����~���=�1����v�������;<�}c�����z� �c�.c��f�s�� �f��$z,8a�`��a'vrk-�u��)e�c�\c�� i���f��$c����>qs�e� ͩ��{�r2�����w��uhfh�'�f�d��bs��s���)f҄�t��=�$�/4�b�`���d�o@�9�g����/mf���%4_�/mn}�5_�oz`lß_�/mn#վ9bs��9���m��ͯ��l���2���?�fl���㿫���������~yᯪ�:�eƅym���j���5v�lio��tqy��ω �3�v>�oo��@�tc����i�u�'w�v�a�n�b��f�e?�lj�x:'�&�{����i$���n�vm�^�e}�"���pҋd<���;��f �pt��vhs^�枳nzh��?ni�[0�i� �}�u¹��c_�d�ڭ��y���i?�ѧv2�����:�l�}��~r�w%��l��n% �����ߵ�&�c]n�f�o[�t����a��,�i��s��,��f��e�i m��~���������#8��_l��6�׎��۬~�(���rgp�fж���~u�f�o����6��p� g��ݎ��5�!���%8� w=�_z���v�i�f�hcp~fo��/z�me��k�k`�� �-��6��z�0o�����]�)k~���p�c���< � ?.]��u���`��qm��<����$l������.�ϗ�<������la.��h����� u��@wn&7���u�h}pi�\m~9���e�(0�ӂ��a�0�~��==vb��x����֌��i���iz��/wc�0�f^��k��s�8��i'�n;yrl�k��i�ɡk�k����h�0�v�ъ�c������ �n�z��@$>���t���:��y�z��@sc� ��b��u ߕ�wq��b�}oj��~��>'�5cexre>o5 vc���a�w�rx����{��5� ��ix%4牾李{}�l񼍞�f�跽���֮�y�z;��/o3ø!��(���_q���^��jf����^�e�wd�:�d��v�.s�s�q��vd��;��� ��l�^�6]�6����͸ �����\�t�<-�ܖ#·���u\ͤ��|qst��b�.sԝ!u�ѳ��p�&[6r:�i!̧�6����˔j6ѽ"����]�lx�4�f�x*k<�� ct���c�c5��3qk��m롖d����#a9t;�6�\)��������fbe��m�@}��nk�o�e͙q�e*�ӣ�vg��6���qwꟆma��w1�q�o�: ޶��2q�궇��e�{g���%�d����� �~��ob� �m��]��������{-z���向8ƈ��@��wxq[�(�uƃu!~�[~c�q9wx�|��t�e���\�[�y�5m7����t[���n"�qr�pk=�޸qyt[=���l�g�,wnow���gt�/o�]�o<��h��}�*u��t���}�< d)(_"����z������}���#���g�_� ���нo���[z�!�,#�n������hf�}k��}l ׹�y���{{��8�џy0<9vukc��va�>t{�_��%q͝�����)��(:r �uu)�=w�c���_�*�i����2�����y<ͽ���/#<�c�^�\�'���t�y�k����wkd�c9~ {�c�\��p�_j;u��v]��k����3�7hw������|�� �϶�4;��)��ն�{ߍ �`9d����p� * [���q��x���5�#��[�w���]u&��l��gu o)�y>���\y���2�l��7�r;"�ü������q�p!ƃ2��`@���gպ1��(�����b�o��,��:�1r���0����r/kv�{�l��s���sϗjg�^�8g?��p�]#��5g�~��x;�:h��,�蟞�3*n�w&��k��nǥ�= ԛdh8�ϕ��z&��yl=uorעgf��{-�z=��6���#����t����5\`e���z���tk�����s�cؾ�g�u�3�ʊ���tsi�uađ��x\o���9v��!⽈���^����mb�?t/�u&b�^xǵfr�nr���9&˵˅�:m'"qǩ���r�r�/ c����`�>yg��z�w��{=5q�l�_9������c�{�st\�k�r�xt?��-=�br��f��]� c����v�>&�ۋd��nn����$��i� �7g����/��1�$~q�wq�z��a�3�`�և�].�z�a��j{"���}�:?d��rη�ι�}�������_w.� �޸��µnv�l��s�����讝�����g�����s� �5q(s'ķ��(m��զ���a��yd���l�e#��)�8?�! ��p�[ ݳ�y5�� �ڙ��m����m��kz��#��e�~� �ulel�k�m�/b�g�;�|������o�{��sݕxfe�q�>_���kr�\�a,�8f�3�d�2�ı���j��#�cq oxa��t�)�mn<��yo�e�a$�d��=��#��%,�/b������[��=&�����ԇ� � ����ҵ��ǻe8��µ49�ci����a"�������2��&���x�':��l�m*/_���z�m7���%�u��}���i]áei�x��}����|b���n]ϭ:���c����;�z"q�۷_( bu�=a�5v?�jc�l_��^~ ů�=��j��6 ��0�ߍ�zi�-�l�9�y�k��;����z<��bya�k�i��k��n������ � �� =7o��r�zi5�v_��r��gd����g~y��a���>�>�欨vb�ryޚ��ʹ��x9.���ۏ�����nz�*˺���x���d��vߊu@��jq?�$���v��7h��t�u��0��z e�:>����v/�, a��>�[nc�y(s����_��e�mؿ�h�����v�:o�$v�e��^�>!� � �52�?�a���r/dd�j���tg��s�x��$�:�lq٦ھ��y��^�h��pn"w�^�z"�sgf㖺$-��r�m2f빵d�x�<=�e> ���6��u�s��s}�'�7�c��<@a�'�׺��oվ�q-�3�tfa��s� �֘=g�s��zp�� �����?@h.���~��z�maaaaaaaaaaaaah���a�*�4omk ��i�κz�y��.�gf7vv������4’���k�ڸ�ܣ�n.��2el1s�=�5p�\'7���f]�~�7���>�us��r_�q�p˹�p �g��繕�w�u�׸�� ��en-���{�k��pӹ'�f����}�{�[�}�[�}�[�=����p_��^�cvc.�����l�a�a��̏��o���ϙ]�ϙ��/�=�/��̯�}̯����0���a�s�9��%l?v {-{=;������>��`����c�|���'�n�g�.v?�[�w�����i)j)n�r�re���a)��3?�o endstream endobj 900 0 obj [ 0[ 1000] ] endobj 901 0 obj <> stream x�]��j� ��>���ai4�mb lxȡh���dwh�s��wǐ�t~���:��������î�g{���i��z��҄q*�p �*�ΐě�er04�iq���'g���x�'��[ v��}�[��l� �miyr �o�ڙ�n��m�hwn�{ϟ�k1@92�����tl�o@�ԏ�?jz>�yt]{q�,�3�ns���x�f��<�����q}�ޗxx��k�h:>��(;0��*�3r��<�)�� 1�y��x��b��~���t���jb����j��d3�� ��@� endstream endobj 902 0 obj <> stream x�� `e�ǿ��9��$����@f&���ab�c��i �p$,jb8$r���*��uuwua���#�����c�u���z������}�6yqm���w���_w�|�_f�!fd1�� �2饯iy�0q��y��m�.&v��hy=�xd�% uw�k��|pɘ��!�iyxqܜ�%� f%�0b�z�?lti��.�'rbd�ո������c,3�ˋs��.�{�q���c�^��[�^�d� gut����׈-� �̩�j��!��)b��#2�3�jڬ���ˆ�� ��紊�uca� �٦ͼfꕎ=7[wl�s��ɳ�~*l�n��w�y6l�r1�����#b�����"�3� �_d9q��yw{������n�|ʜ �†����sgή�h�n�ml��x﬊��"o�a�� �;���5�{aj,��" .��=w��h�a_1o��3�j��z�ݞb�o�\�?1%�,������&��vy�篾��o�}��f�p�dr��!�����y�d���o��t�����a��b�?��q��i�����j��h ���b����o��~z��>-����l��}�e�vz� m����ߢg�>g���(�yzl�^�z�"y�/a���t}�j����mb�ӓ������foc_�:�nڬ�]��[�� }���w�^z��px�g��.�o�c}��}�^�w�_��k/aߣ����u:d�b�6��}�v��q���5�q� �@致k�a'h7�$�~$�cګo�o�m���ob?�}�s��w:��ކ~a����k� � �_ӻ������� ��c�?�0�[:��b��~gg� t ��q�e��۹o�x��o�h��o�h��o?)|�i��o �~r���§�>����'�o?!|� ��o�~b���o�p���o�p���o�@���o�@���o?.|�q�ӏ �~\��c§>����džo?*|�q�ӏ �~t����o_����o_��#§>����g�o?,|�a�� �~x��c§>���釄o?$|�a�� �~� }��~���y��§>�����o? |�����_���§�>}�����o�'|�>��� ��o����os��7�os��7�o� |�^��� ��w��7�oc��7�oc��=§�>}���o��g��=§�>}��黅o�-|�n��w ��k��]§�>}���;�o�)|�n��w ��s��ׅo]��ׅom��§�>}���;�o�!|���w�����;�o�!|���w��]���§o>}���ۄo�&|�6�ӷ ��j;���ҧk��n|�=��o��j>}����>�|m� ��a������ �o\p�m��uf��ld�oc��7��j"}�!����ߏ�-<��s�]$�r�]�h9��c[� �h$�d�ڄĝ����5?[��a<��!s��׏�f?-[���\s�]$��9�v�l�jhl[� �h$�d��xc�yl�����h�?�u����?[f?2�:�}���}wy&z���&h$�d"��6a�!�i5�j�lm�od-�����⟕,a�c.k�@?� ����t��|��s�up�]$g���&h$�d"��66ǿ�vf��m4�v �x�j!?[f?-[��x�=k c�6a�9���d"�h$��&<�ꏭb�5f25Ꮡ,k�6 /�qh���~*�j�go��xc�ѷ*��uuk�]$g����&h$�d"��6�]��`0"2��kb ���5�j���ljry �z:�jo񆼣ou�!� i= �jd׶6a"�h$����j��c�����&�1rhhh�ċ#(,d|�0p`���ϟhow���xۀs����w��%jtr[� �h$�d��ĥg��hfd��_c&sh��*�f ��/�eqx����0p`d��ϟhow�a�w��?��s@y&z5&��m�h$�d"im��f���c�3��g�c���v��p2�pd��� 2`�ѐrk�>�=����ڀ_6��u��ֳ�ݡ��mk$�d"�hz�.�������[�?��?��_���6we ժ������9#��[�s��"��"9k�.�mm�d"�h$ik��t"��b%���s�� ��1**�(z*��v�e�a�n~z��yh �e#k���#ozr�w)�-�gz���egz�6/w�:~b�ʣ��m��l#�gzyǟh���^t�*9�ԑ_]�ۢ�����mm�5�؀ �jn��.�q�ky�����x��fodn���5�)q� ��y�4��������\g2�5�qൕ6jy��y����v"�~3�1y3����t�0x��_]�vgu]]�rt�ww��&�6w�f�t-���/?s���-k���p�y&.m�rj\l��[r2�t� ���r�”�򜲚d��nv�?�z���j^p�1�*|�y���!z$z5q!ʕu�d��l��:���v�na��x�u�)rg���/�2���4z��vm�ʎr�q�z�֨���f6�ذ6� �:�a�w����gx�'_ r_��y�/�sɵ�#ʣԍ�8��'z�rr� }�7��&�f�v�gh�zp=d����~aʃl *�z=�1fvz��g^$�<�;��]3�<������6���ͷ�����i� ����������� ʞ�ކi���f:�t i���c�i9�&$� v�4��fݨn���}4 i6�r$ s��/�np/�=�]]���(�k�;e�'��@}<��q�����y����������.��!_�2��/_������kչ�x�-;��t$k ��s���a�z�:s�y�y�9��:��%��u�ѝ2�bj���_���3wihzp�ς�>���y�> �gf%]�������p�iż�ż�z/�i��� �i-/���<��u������q�m����u�����sk;u�x�})(�_��c�y�;e�n� �sjc�4��uyv�zi�ar�4�7r��v���[ԋi��<����bu��р�籈�� *6��e����=��x�򠪠ea�-��� *2�v��uծ�����d�p���l���y3{����x-�����xo�m s< ��i��i��s�d�;�k�&�ll�t\�z�j6��x?�܀r���_j�p�z��b�r�*�����6��)ނ��}5������s| i(jv��(y�k�rڠ�b$u�f���馶t{9�q��}δy���ioe���ۃ���v�`��a��hdd�d�d����i�]�ݳ��^��p�p��>b�6�5�=���uz� ͝�=m�fw�����u��a��=7l�0m���s�������3d������n��²*�p8�k�!�d��! b���)��v�1�>���h�d$�x�������׈6��ە�v��/�׈�p��� ��q�?*z7�m�^�aq?�����c�l����nn<^~�����d�*$�r���ajg�bڄ��㱌s�)�aytytm�x{f٩#cd�ٖmsbp x��w �u� ���с֯�z�j�y��v����l�p�ǒm}"�:"��#ۊѣ�iv%j�� �x��bs<��8�_8�wz�sz�tz/t��:�ku:�pe����c�[_�[�٭���l [ͱw�/4� �����0 ��>g4hu�/��o�"c�/ y�/k0��|y���ӗu���&���׾�c��(�%������lmd~ �4��)����ɗu�� ���p�������vk�q��{})���?�r��^�@)b�w�r���n_ʭ����d����^��j�g��i����v�%��{,��3�n�8ߗ·��;�c�>wodݸ��0���}.q�]�%��l.at�e�„�vj�����p��o�v~�� �}�7����f���|�|�])u���}�k����:6�g�o�3�ṕ:�=i��${�wao�7�l�?���\hũ^��j��k��7�>� )�p3h�x,��r.���h/p�14{��3o�=�5�>���ؐڍ���uܔt���){���%l�o�҇ll�'�4�4�4�4�4��˔jr���:�:�#�6s�9�l6��fͬ��ܡn?�i�^�`��̨q�ĺm�����0��׎7r-r�jr�7���f�x�%ՙ�q���e^s�jk�� %��w��kq���q<��l��-�-�� �vvɗ���t4�������h� '�:^5(fp�e� �~d����=1�?$��wuqi���.e� ��w) ���f�jev~�f��ge��ٵʕ��x=�6���%(u�fy<��j)�w�v � �p�&���$$4vz� �p�� :mk ��x��}�[�)9�й�v�;�����ܕ?�ܻ���1�e��������е|r�t�wl�뚒���s�tt�hs%o�p��pe��қjϋ<_��"�u�wv�~anq��nm�w��l!,��k}я4���|_e|_e|_�=�ž�f尢��3�!y�b ��<�y���vu�xq t�\�e#�my���r�v$ޔ���͛���m��/d����:㶰 �&��]9�l1�3��͝;wo��'c�͏u��u�y x<�����z���?���zl�e��rfg-�z��&ks�a��2tg<�� a��0;aa��5 ���ab�s��5 �%��q5�y ?o�s>r���y��r;��ը���ɹ�� t��]�;�t�dr!�b*a2�_�{��"}��э�;�d��5j���3#��,�;�5�6�of�:�s��y�ōyvvf rߠ^��a��f��������dp3� 1��ƫ�l.�mf0�p��en�<��ƨ{���d�_�8���{bs��':�ڹ|���pܝ/��!�����ai"m���v�v�t�u��@z��bexn�=����у,�����y��n�h��%��g��j�a-9� ]hszco�h�s������>d� ��˪ v$��h�����}t ��w8��a3�me4���e�|=�}�6������cg؃ơm9���ki7 be��=��3�7 �;�q���nit ����ǘ,}�5a���k� �݀#�l��n�;b޿�ox�#���b}��a?n��;���4�f�u�kzg�z��ξu��s����z�)��mwʁ�#лc/�y�q�}8�p��q�g�ql[�v�:�6{[1*n�u~�z��z_�a��hy$��dm���}�w�d�x��rqd�����@%˃�.堺x]��6��p���o�j2�o5j1��`>cacv�ˎ���j�js]j5[���kԕ��nm��q{�0�pa�h�h��a�^��$�o����po��g*���a_�9��n�j������u�m���=�g��6���g�[�n�r{�=�^b���5_�,ݕ�� %w)p�)���tv ��jg���",�էէ�5m7d`)4,5`��\ċ��٭tsҕ8�\e�2b�e�2k�2g� g�!�v٬�s#u7�m�z�z��������m�r�4-k�m�n�vi{�ڷ�!�0ݰ���1���8�x��n�&� �i��t����7m�� o� ��ɀ��ҍ��\c�j�^1j��63ftf�3���7 s�)���a�� �r�a�@�f���*ϱ�n�t��2��f����f 'yw�w�ie������սz�v���t�s�r�w^roto��l����a����a%��u}�r6ک�p�r����-���?l��}���%�oj���r�@t� ^�u6tkt.u���߱x��]iu���a[�{���ԇ�0%g˫xy?�v��:ٛj0�qyw%� ��1�3��j�=�� ���,��� �v*�����m�� �����lx�{l��r\g��)4���ee�qk)�l���jw��"6~8��b��(�y�-�a�b�_tt� 'b����o��/b�_3^y��]�-˴|x�r�ߥx&�%(�kw�4�,�hs4��u�.]�����,e���t�����wb�{ ƀ�f���6_��y�vϻj� g8�q�𞸍f�wq.��(�f})m���' r-�7��^���/�b(s������؋x?� [ �]h���y }��q��a uk��;����( ���w�c4���y t�w��j�^�v������,���3�y��u&|�"�7�õ�t�����ԑ��v�a � �3�����a��k�uy�ͤ<�#�v�<��j�&��$�nf��9� ���.g�rl����.�}�5��,�u�ih�tg�3� a�5:�p�o{ �-��zll?�^ɲc���[�g�������{�ǔ������!��;8���i}ɓԧ�c�4�s�_kss�� ���z����]�w"��w� �i��*��jekq� �ws��w����kwgs���au��p�|�@c\�� �}��#n���htl4����f���p����mkj0�l���i۞fbzk�t �q����f�q����ϙ'�n���]�q--b3�����h��tj��r}v��v[ɶ��l\u���x�ڬ�q%��h����jh��7���ظ*�`ta5��vw��b#!�7�(h�q!�b-qh��5�� �иl��9h<�@� �p�j���w͹��t�@�[��x$>j�vqn�����ȭ�8j���y^�����3����gf�����mm��o̵y�1w$[�p/ӻ'�9��us���m���֥���x6��˾�`��/���g��}�ǯ9v��1ag~���熯��g��x��� ��?)7f��g��@;\�z�р4բɘ� ]ո�eh���),�vԉ��>tq ����xm�b��de�����h9�rf��������gn�qpq���5ž��g�`ȃi����&�����,�i����a������7�z��c�nw.�[�{�q���񸲻}����,�)ϗ����k(�#�r q�y�m:��_b6�a�sq-��xg�/>g�v2m�bx��>�z��:4;�]*vt}1]g���,`o�ecu1p��<1ǫ�@(м3nsmq���ana� ��_�\vy�0�!y! �8d�b�g���j����fg�1��뱻0 %#�4�i�d�(�_rǫy�?��Ϳ]���׼tq��qu8����.*l��'q��[w�\~�������e��{t�aœ]�u.���s��)hx�cݧ�4�s�%��4 ��t���np�����)h},�8 ��������j��5 �٠t@�a0c �/��s4��j�셬m�m�����|�#8�n�7�<]:!6�ޅg�"�ϡ3蟩t=h �@����<�[)��br���%����2��1�_������v� cuš�u��{j�p����i��0z�m�%s� /�k4>���o5��o�w�&_��.�γ� ��?5����}�i��5�5��;�w�a�k�k�ۍb�� �}�7$��i2��i�-�m2/�0��}fg�}��$/�k'c)��04���ǀ %:��eֿ͇v���a�:���as���}���\���d�%�kn���dm��n�oʋ�(��̂4�5��� ?�ӈ�ox���(k���ds��!�dxc�]�t��qd ��6z��k�:��n�ޢ� `,v^r`��n��km���/y_"ɹ�{���ou4ݿ��ǯ�:���/^�o˧ɗ�dm�2��y��4�0e�o.��h6[ '��v1�6����z�3���`�k#o�q�act]����ؑ�k�����r��j�"t���ɤh�����y�-���4 z���v i�l>tb�eku�(zb�(�o��>��u�'��������|]o�^�w��`��|~\{ ��<���c�h�!���;}9b8'�9h��pg�iҝ5ԓ�n�"a��t&7��j�*1eu�u���%��-da�sb!2�\v!�xb�m��� vs3<��@x9u�?ytg)u�����koo$��$�g�%m�6=2{���= �.��ʌ����x՚e�e��ԏk�]�o�|h sɖ{�n�w��������e�p���p���ۦ� %[��lj[��q��2d�a�t���ǂl���fk6tcfn��c��d����������� ��y�"d9�~ ؄viq���1���h ċ�i&��f�]�34�k�kmb-zx�p'�ՠ��q�x����j�=� �od��[���n����e�0 x�wdh�ـѻa%tu#w�� ��ч~_�c�:}w�a����x����|�_ �k�i���ڄg�^��n�6��`� �\pf�3��ʲ�jvm�o�o >b?i�fmt�d����xd^���. �ry��4/1,���e�y�d���}d� �#h@���}�蟀�(ң�q��z@�} rȇhy�d,����{ѧ��nt͋�::�o���h`}�2�b:ł�(�b4��u�ny#ڈ7�0!�� w��l˘��� ٕ!�c.�/^��`��g� �q�v�^{iy�\dx��ٛ�w��u �q"3u���v�~ͳ�a�=5�ع��l�'1沆`jt��6��_mu<�t�_�tjpŝ�j�7�6�`�hxg�t�8���1�<�z�f!ɱtԗ�q�<_@pǀg� dԝ��q�o� 0�f|�9l~�f��zmgm_�` s��nqn�);�n͹���䝾��$ʙ���'f5�n@�`վ�n0#�ζl\�ú �?j��� �������j�c����b�q�_��y!ue��:'{kf)��4�׉f����5{��@��mo<�,��ƿ����7o_�����ղ�7�&��޲y}|6�d���ۿo�rp�swi��ϛ�bdfcڙ>�e�şp�q���:]�&4%�*��׺��q�v���m�&�.d�n�#(er)������pn^��-�ޕ�� ����<ǽhw�h�m ��gũz����!��$v��u��z�=���f�'�5�[z����o>�??�x����og�~c�c��u�j���@�xn�pmh*5mi�g�'��]m]�����kr7���ko�mc��=|��ѿѱ͵�s?�c�ǿ������?ϕ��s�_̟z?m|�p�[ �&���6� �ٟ`�f��z�c�h約z ��@>9�0��e���v�,� l!�,��!j �y�������qb!���n*c'nw:<�u�7�2�*��ܪ�fa�󡅨�u��j; #v1�"�d�� ?��o֦��wo۹l󥋺���v�u���~����7�n�/ɔ�<�λz7{r�j��a$< ��r d�r7&�a�p�n�y¬e� � 7��x�:o�onq ¶j|��&$%!�txe(�=���$�h�cff� u� ʙ �xy�;x��e" �g�c�ct��qb?6�֪{�i�����z���f��x�f|ވ���虡����~�(9��⎽�qŋ�j1�n��j0�g,�b*d#e�#����m�a=�������-46:�t�̨���n�8��!���o�m��6l{sэ��r���>r�eȳ�q���?���@�6�mk��vw���e*��dt�=n��[/)�xf�-a9�_�rfw�j3��io�՟�1�_�'�i�(v/�� r,��:�8p$��! x� ep��9�#� ���h� 8�mb��" q� 6,p�⦷�����cc�e*q}�k/�p�gz@��l�6d��ms�~�?j!n!7���g���>����օi9^��� �^}z�[��dg�b3��m��&�s�m�\�lq�kn�j�bqix����z��z�^ǖ���c����������a{]|5�z�=���g�����׶�įc_�k ��6#q�p8h�o���n� �^�����˾ҏȏq�%��f�a��h�1����jfa��n�g b���� 6x~̪�k8��f��\�ʚ��z�j[���m����w i~"�hmf�$��a4 7�z ʨ�ú�r�pq�$jb������_j��.���e�4���4�t��1(�*�5��� ӻ��qe� �3g�r��q�v���o�wl^����߷%"^umr�'��޿�{��2i�v>�����$cuq� ��0�����zv5/���ޒ{������ħ��$��1���%��lx �x�����o'�ls ��߶����"x�'���no>�)�����-��&�_�h���>�n�c�gbh�4��� �]ao̓tg� �.��fs|�;�]�ħ�h^��iesos_�����)z���pҗa8l�����؃�wr�ܤ5�7]���;�n���̮��_x^�.�.���-p[x[����̻��b��|s[$`p��h��ds1�fj�b*�������tu�p0x��^���)�a�7�n<�z�[z��i���z��`~�� 2��a�ɤ"ck�� ��c��)h�!�f�=o1hfȟ�hj-�t♵f��� �u�e��g�d�զ���,� �p ����t*�<}�3�ѕ��"wc��u��nh.�����c:�� �����/x ���h�s��[3�hr #��0��c�vr�ϡ _�c�p���:����9�* gt7:v��*��c�2�v����sc��d"�>y�����������ȣ��go@-��ɶg��7��ʹ_l)���r��ۻ�t|�#g�@3�n�8y�%��%i-��bksms�6�^�dv���� ��|��z���da�;\�0ͻq�s'.�@�g%�u|���j����c ��6�h��cs����� s�$ǵ�^��he���tt����գѫ��l�e�fn���d��y�`�$���tw� �)߅\�l��a�[t]�-8 ��є�y(���:k~r�a�tt��50d��yni��)�j��hnv�$�dyt� {^(_�ކy'qc�?nͻn�\g/� ת[������s�[d���e!��ɀ���yԡ�02�ؗ�'�(�>,7j���k���jߚ���v�^i��t�ym�5�rc��޸�����`#c�o3k�' �h@�g�#�*ѽ��~����tmb���^i�⒵�5ye@�h�l����]�*��;�;������s#��8�}'�� �4���=�l�h ��d�1q���o)\�u�=���/r��nh��q'ty\�,���q��/ j2q��iмhц�/@rd��)ce�b#�p�\2�ֺq�kt��q�pj�v"�g��(�_�#;!���&�n;��tl�ve�0���g�}�<�۵�=s�h��~[|��\� n)��������k֮�th�}߻�������{�*ڼ�e����5�������g�t�t펒���r����bшe�xmђ���~u� `�j�j�/@j� ؕ�î1$&~� ��>���wex)��="���.t �|�p\���l��f(�|u��e-d���@^��(� �uڕn�>�w����{�1=��u�j��d�>kz�}^ ��ʨ] �{x���쌸d1fj�y|q�eq��(����������c��g���$6@ q e�k�i������,i[����� х��� �d�&�v�=�yczw:�>�, ��n�ҍrcv�d{� )��9��z�t���gp�{�r�wȶ4�5,��q����u٭�����}����پ�� oz_��5��}g:�0�����`��7�/��d4�;13����\�]�{ez9�{��ُ���֊ґ#�r���j�%z�>j$���`����|�i���wv�f3�>��^����a��l6���v|�t�, }�^��jpᔝzj@�|�e��6;q-����� g�0;��l/f��e]h�r��z��2#��>����a���.(���b #��-�҈ei�%�q���-�?�-z��be�c?�"� "���� c��c�y�=q�t@mϖ�y`z�u�epl|�n���l`^�=3|,;;��'s����#5������󒡄��{�����s'�~{;�t�w��we�}z�}�'����"sz����<3a�$)ڝ� r3��l�mx�f�)!���-9��p��l~/�m���gei@�ů��ltvw��.�?�[��:*��:��a�aa$-uȇ�q�:�˸��[s!� ܀d�~ҏ�7�����.&�x ���g��[��ˁk��um��_o�je�w�7�k�]�mxsߔ�'�ϖ�of5�]��fbr��tf�eksi�ԟ42��u�u��� ����ҡؑ�{�����8_bl'�e��� �m�k,m�l��m�p��n ���^�}2�^���}7�t2�ÿ� % �* �j�ŭd��\[j�dۢ8��5�!�x����� ��jzt9pi���������4��e�v@z:c�v@u6�����u'a�κt �я����� :�e�(�8q�:�u�;�j*:����"v� jj2^�� b������nul��v�uj$zs�/f(��,*uyl�t�av<�w������ �w��g�����gs�tw��?����w�[ �-�o��v|c���h������������?n�d4>�3義�q��<���k�c1���� 9n��}���{�kozq�6 �w'qs� �"v#�_�n^]�f݊z���fo����֍�ܜ� �۔x0�z?{���������8(�cg�[ߔn�.�-�k "w$`s�(5� z��'*q ת�xf.h��=x�|m�c<���|]^���n�ޮo�p�=�| �x�5$c� �y�p }1ene1���<��6�t����x#ݘtd �qb�ǭ#ʭo�ud�wf>�r���4���� �2�h�^r���ѝi ä�/��� �5�(����ej�k�����g#j]4�c�ah�u�9*�� 9d��� �]�"&�_ʨ�f0���ul�f\e,����a��me�u��u*�(h�����=,��u���ݾ=�g��0b� n7��� ��ݶ��g��.u_�]ŭ5�(�<�lo��cn)�^��.7��:��jj;5���^ʊ��gƺ'rs���u�i!�nzx�% ��Žn�)�"=~o����r� ؛"vl��c~�嗁�:�%��x��� ج�8� "��^���9y�y@� ��r����:�a8p�� �z���y����9�a<'�n�����>�few�{���͸k��y١�u�������2�!����l�兩�f�wy�|�d^���h�e�4rr@, �������hl:����lųyq.��ts<�'��>|(�l�"4��y`1y-t�j�i��)�p�ʀ�\�e�.f��4բ����1?��dyu5�c w������ l�$7^4r�aٻ 7�ᩣ���ޫ9i�iu=>z�rr�c$��\9����wfnbnb�2=�g2�2����`*�q�f�3�����>�� ����m��y���fƭ���m}���.�ܱ��/���|l�>�������w���f�: ��d.}f�3��g*���k���{m����-_��{�q�/z�� ��&w���}}b��u�s�;�a:q�c��d���%�h�q?�yz~upy�����qjv.�������r� 9b��z� b�,��q���)tz�)#�&���op�,�����1�}j�t��i y*i����ó~����d�~�c�giǎ?�v�}�1�ܓ��)�۞؅�7dɡ)s�t��t�g����lj��^��͟.:��l>n�o���p_֮�թe|qj_��&��s�|.wzn��i��s��n�:u�ʔ���$i��>f��i����榩8�2��$d�m�ʹ29'/����iz^nn�� �7�y�ns�wq�u�ժ�,�s}�n�9�z}�u��j�q̺�������� ��zh�[gһ5}e�ޮeo�*m��λ��錧g>�<��s��%ɒ'g�nm➖��3�θz�ژ��wn�����69}1׼�kr�:�=xi�_ڒ��$��* ��s��xm �d.�m�j�h��y�dz8k���d\�t&���c��y���l~��^��v˂��2�l��� f��h(;��_������k�g9w|/4}��3j�x�a�)쳯���8:_�ą�'�ӎo�fr�kx�� �ty�_=~���xƙ/�/�/@���$y�?� �1������p_��� rza�hv �'���� ������z&���ҟi�(��xq�$���[��f� �,��;�q���1�$�u�?�qϧ�w�0�g�8�{8���'�����>���f�8҇#_����8d� w1�g�'�q��t��i����_l��_<�n m|��u��d���r��i�k�, �p�6q0q8>)��'������ב. )]��)㝌w��������)��_�����%m�_���i4��m �w�s4����ic֞�c�i4���4�f�hm�i4���4�f�hm��j����o�o!�db�("o#����!c"� -yd��c2 ��h9y< d.z>b����dbą<�sɒ�j���� ���\�`�����j��i �a��jf%wez�##y�$���i\�h'g�g����d���e:����~��e�&��h��}��i�l�h�2�hk�xdd%{v��$]�5�n /�x$k�k�n$�ʪd:�[${��ʚt��t� �����1z�ڇ�@���`t6�e �`c�l(ђ z�#�p� �`c�l(ђ z�!����w2����k����j(at�-a!��13�=&��if�όk�� ��gc 2'�����y����|f�2z&���p�8�qc���uѹ�kԤyp�b"��h;�v�&��uԬ�iވv3�(��wh ��t������j�p;���y��m�um�pv2�v�5b�w�f���ѓ�^���hk'�?k�'9k�r�y q`nt�r�fa%� `��@�o�4�f\m�u���l��/h�����5_�}m�*g�wb�z���jd�ы3�7яjke�[���y�j���z�og�jr��a�ia� =q��,�u�t7*��֋z�$���i��u��f�6\�#�uu#���>��k�����)���� �jz���$��-;�x�ȿx\�ny�1_����#׳�l��lk ����!hhe �������ۙ5�le�o���5���"�,����[id�>��v�1v�ys��x������8йs���;���gk'�y;�m_�c֑md �i��r�#��yr�\��=@srn�esӹb����j���m�q��}� w�;ν�.@��p�zb�c��*�r�h�r���m��zxwnv�p�x'�ńb��&�|- �f�|}�pv�&r��oo9�ν%%r8�m�o�b�a�h�7m�2�j�6�'5o�� �]��em�v�fj2嘊lbͬ0o0�˅� �byo(w�b\��]�[϶�l}ܖ�6�mkm��y�x*-:�ݲʋղ�r�r�r����i��^*h��r��ďb�\�&�� ���by�<�sx�r�yignb�x�r5���q�y—�.>�oai��?�t��h%�k%%[$�%������pz!�������첀���"|j��40})����rd"{%�$ҁ~�dy�d�q6��&!�����j{��%��p����,� ^���j*z��5)xw�ץj�s 4d�a?�רrћ�j��rb����w��y�k�u�xtf�j�kp֢�cy��h$a& %}� ��y�c�@%t�f��v4�m�^i7�d�c__��r�����(����;u�%s�8f9z��=g��,�|=g�7�^��:`�<�:�$�`�th��ǥ�w!k���'�e���#̃�ԅy�m�r�2~fd_ t���k 7���/�{h*�o���o���ٰ� �� -�� ��}��>"���q3"n�������^^$fr�����t 3b�aw>/b#o�k!��r�y��z��xn�o��c�q�c�b>h������, ��5�me}:f�q��%̛r�$md��æ��1��$}m�k�~�o� @�p��� : �c�q@.0x�*���ґ���v.� �u`�:x�e�z�:ο d� �� ia���� zظb�`��)�y5�5��"h���@&v) za�`����eü�ϣ> ��z>�� ��#h@��a4���w*3��]-6; �&i��l?d�!�9~x�#������~�z^&�w�m�����t���a�����a������ d쇎���-�y��� ��3}�r� �����!h����9~0��(�� �d���`�y(�#� r� ����h���k�>�q_�~h5���u�q���8�g>'�|���� d���h�9m������h%� v���@%ꋀ�h����r\�����g��z�&� q��� �d�i_�y�~� w^c��a�=h�i ���h�&zԁoy��a݀�m�&��$�=��z}��x�6\kv���q��q񳃴g 3#� ��w�{ڿ�r���0��6��@@q�&�]��@;p:fw#ʘ�ed��e#�� ��"7�r�'�4��1�����u9�hacj�6���ƭo��.p��r��g��de-�|k�� �=�����(m� �k?��n����������b���a-�c?�.��y�����(�� ��h�d��h����!�:�9�~�`%�[� ?�#$�a����*����chk��.h��щ�n���56���)���r��w���@��=��b���³��� ���f������}�~m����}���fތ��jf�>�[oc��� �d vw?vw?bj?bj?f�5�������x]�ql�u���8�m�ǿ� ��$�:ѝ@� ~=jx�([h3��jh��f���� pn�dqou�֡�ytkvat*��$�޺��*�n&��8o0�����f�;;���j��(uٍv`ż �#탥��y��׆njs�.ib��e��t1ݪ���xy'���'�e�z�v1:�7"l�pn� �� $����)�������z��i= ;�a�����v���/r�8wc�q=�c��5a�d[ �3�n����'1�w� ��ws�<��8��8[�y��{�����s_���f�q� t�j�%pc���jp������"?�f���!�>���]آ�w9��i1vdc8�a��t�g1��=��t�=��tb�6�ne5�q �~?�ܘ�!�e�#p�\�d�f�f�ōl�7�f�!9��g:�ӣ�t�{[?x#�b�ml��b ���q�hly�.� ��슭�e\��ubd����"�3�*qf��h\xo�~zw,��l�q]a�v֮�jj"�1�������vx�y�n����jq�%��џ�g�q{�<�y�#n?���d&{%����.�g���ӑ$�y$)va�/"��kh d.)���"%��#)�$yf� h��gx�h#?!�h�7���~�����~���dq�p�����?� <��ꉼ���\>�o&j>�o%s�l~,�ə�'�|>��%3�<>��� �r���_$�����_�w�����r~!��|���!�|-_g*�zx�뼞דo�c�j�ěț� ����n�e��|/��k�5dk����0}o�\!� y�|�[��2 ��c�*���y� �����@?p8 �<�ǀ�"ί���k"(} }�q��˄36��b��e<"d%�n���(u@�ї��u��4?�����)ðϐona(6t 0�� � ��)�vc>��jd��c�b� ���7=nydz`"�;`�3�ͼiev0�bs�t�r�a>u��-g a��dd�s@��� #z����los)hj �s�d�9�"2�� f�rd뭠[c��1�������q�@#�_6�.�v`-h���k ;07��y1c�>q����q�i�~��!�!j�����l�l�6����e�[�'ƙv��na�����8��ѵ�ʌ�}tvdt�}�z>�_��_�?��ɵ����t�b��#"�;3���\�p����a��fd����1d���~�����@�o��'�>j��)b> �w��b���0���g�1_��\�� ���&�ncc�_a��zp��͵ o^��w��.�ԣnq4�a���� �e��j�b��h|�q�b �k����]���[��_�/q���nn�0ԙk)�{ ilc�*�!o�)�6��� 9q>�f�q�"��)����}e��'��e���hltٿbl��w0� � 6_z~ο kd��ec�oq�l��\l�`��-�l�m.���bm �=o�}�喳#�;�1�����z��q�[ oƙ'�ft�χ��uy��)l v2d����ؼ�';�����;�w���g� t�xrz?]u<�ӫjq/���@��(���/� g8�����j�!�a�r�"ꛫt��f|<o�g�'���qjr��� {\���n�͖�&)�9��i*{��)y��m�-��/%j���$�>��]���a���]hɕl"�d����%�$�$m��'cd�d3�y�����g��q��>���m�ύ��}[� o�ޑ��f����vn��*�qە��dn�����s���t�]�qw����x���"� �f�3i���ʮ��*�>`8���_��࢈ by]�m�j?@�9(��ۄkx!���i�e(�g��r�ـz��h\�`�~���y��t�:�dz���z��l#�i?9d�����c�9����|����n�[��� _>[��l]��|-�|]�ƣ� j����k�@e�&�&՟��e�4wa�:�.es��ڇ�a�tsmd{_�h�m���w5���h�joj6������������ n��3ڣ������'��5ap��g�'�b����!���[ih���z?� �uw_n�6���`}�z�֧���2���>�����$�}�!�}*�)�u�3����u���_h��ђ2q��m ��@-���� 0�9��a�b�n�f`�jov�t{d���c�q��x���0c��%�~�r��cyx���>n`��mh}(�#����i�il�:z�u�o! -���ԁ���������c-�l-�l-�z��si���؊�ae�i���ĺ�g�2a^/�'9x��$w�����yl�*��f��g�h���.��1i��\�-op xr�c,i���[xzk�e����k7"���]z�y }/��-�[h��g,�����jy5�����|9j�o��3�r�3b;�;��!�ҁ�9o���k('�� ӏ�?�o6��x���puԍ�8ռ�\{�3}�;x)�w�m���ѐ�d��k{h��c‡�؜�]g���sx]?�k��c����j�5xk�s�� v�;l���=a�u�{m�b�po�ѿ��֠g�ѽ#�:ݻ��v�{_p�5�n��q n��w ng�;��yߞ�n�?�m��{@_�x}� ����o���ݠ��{����������>xb�v�"x�zؓ���n� >�v���� ��v�;�u�[�/��&~ �ˈ��a��o����p����"tm x �wm�����d���~k�f��aļ��l�ث �����y�t�i;n���ho��&�a���;! ��%k ���u�g�y���tf�:#�sdvuy��u�?�)te�3]�v������>�� �� ���}����zƾ�z���� xim��^�]j�7p�ڛ��2�d^a7���lw�%�ju����p�=�� 9����!�}��fj�j%�_��qھ��{�껼�0j>��̓k�q1������֢��=��ѧ��}�w/ڍ����>�=�������y3��/�?`؏2�v� �c��he9d}fy����x��~�{�q ����m?�=�e,�f�,��� k��@�6�/yօ��w��bka�ii� 1$��~��������bh�}�{9���&a�9�qt҈�im�|a������^����ĝ΢�ཝ3w8�����g���� g9¾ ����p�2���}[ce��|;…�>��p�c�o_�}����]���l�v�]������s�*g��r�fw mw9�>��t��q�w1��w ���zx�8�6 wx�^�8�n��]y��ά����jճ�u�uس�5�����u�u�s�u�5�簫�ka�1wewu�iwuwm�yw�/�4]�=��{�kߥ��z�eĝe8e�����[�s�5�������:�3�wg����������s�{���~>�����v��t��t�� ��wy�զ.w�}*�����s��um� �<��"�por�b�$ܧ�;2�q������'��q�$��]�# >2��h�:̢1�үc�#��e�q�>.j�nv��&��]kw����b׆�*��ͫ3ή���t�vgѵ[���;='v�ѝ��p������.��&�e�c��5?v!w ��5[lg�m�?%t���v��c���}�}�:�g�)�'���u��e��gg*��s������ ovf���v�y�b�t�s�ce���p�3�_ :�� �>�g�g����,�[�;x���吳�,��r�=�ϱ����������ag�]����_>��od^��>�����?��;��f���g��:���u��·�v���]1w����t�"�%��u�f�χ;{���y�z�u�:��mm�s����{8=�p�eyj�p��?�ڑ�< ��h�#����i�٢��2�պm� �s��i�30��裝��y�����}�˶�oj� z.�f����m�/q:����*��t�d�{�ӂ�νxo�[��n{`s0����;�3�h����l������a�=�.�㮊�)�{�ؓ����ag/�?��x���:o������=i�г)���{2;�,�e�h{��&��㢺�}��1���#1 !d$�k�gj��b�1xb ��xk�!j�g ��^c�5�x���z��z��zk����^k����ǡ%>k�k�����=� gf�6��?��yk����k����k�s���: ��m {�z�7�o�x�z'�|���4w�n]��p�q>�4���!�x�k�ûg,8���ծ�d�y:�a�a��7�p}�s��k z.ѝū����s�����{�n�3�1����^?x��z�t3�\l���a�ߠ9�{�go����� � �a���y ��)���(hn�7ziitc\�r�l|f��3�bu���y9���u��2]5 ��~alc�k1 r���7���]`abc�k{[�m9�hd}\�:�mw�mm�l�ki�֥�v5n�paocg�������/���ܴ�|������ϭh<�r��j㡖 u�g_n�o�ս'z�l��i����h<���p�{[��6�ȸk]$�eޫ�;8����z�,�k��ҥei��z�iquޡ�>�ˀ���&yiߢam���x���j�~[j��i:�̚����mx�����;�3|��ҡ�4�-�����x-7���ѳb�g�eq�b���e�m -�5�]�89mζ �� <1x��hn�f��ģ���1�y��mhjoٺ����g���ta;g.��tբ�|g���� jղ}ѥ��gg. 5��^z4���rʢim�[:����/a����o�� �ja�7�r��l{�}�x��hm���\_·��b������1�@{�7���'2��e�)�"����h�*��x-�-��&����b� �mt�)�b�xz�3���y�(�kb@�(��h�bz):�u�{�_���ή?���g�'j��1��q!)�!�]ɡ�w� ݫ^�(�pk��a�!� ��a�>�/�j�/����x�������o�j�����7l�mir��a[�����x&[�:����8���9�rl�?�����yǻ�����_�k���8�o�r�cbc�bş��p^�\�[򺸫����������� �x�#�ȿ�ώϖo ��2oj��;3�3t�-�o�h)�)�q:�����ti���奫jז�/�t��t[��]�{k��,=rz��tio�y��������/ٿ$d{��wւ�l9[�-��${d�����dž"o��$t|f�*�ʥ�&w�u�.e�"����"^�.m$��b����^����@^,��3c���3�0�o���әn��y3�pl����5h �2#9��@a`b�o�i�p`j`z`f�607�0�h�� �� l� ll l�tv��o�nn�.�{��}��a�д��鸞n�s���v��`��j�i��ӄ�`v0/8>x �˂����s����,����ɚ�~��]-��k=b���y �w�(%���d������@� 6*�=d{xt�f�f�*��m��m�`%�b˱�'l��|1��yē�[��j����)ۓ���i[���֋$6�jb g���)����m��z3�y�q��^�����n�vx��5ğ�����s��r�r�������m�-�m��]޽��ރ�#���s��y�%�u� ��y}q�$�0_�/�7���m �h�z_�/�w���?o������"j��rzl���o���b�8o�m �����*[���f�f�qb�u�_ #�m�� a��*]�o&�*�¹�j^yqeby�� `��2�lre:h��������y�y�2��e�ˍ�9��0������we�,�i��� ���u��� 0t1�1�|�f� �z���k\3p�݂��y���f���3�a��3o�� � �4v3�ۛ�u�qr�����f����j=�92_�='�mxwnӧ�n�ö핓#�t�)7t騜�|g��p_�9������1���r�m��d��u9���r~����a=ۢ�r ]��e��u�t���nf�um����q���meg*�e�;��ی�v:����e�m�h��g���\y>��d���lļ�!�ȹ��z������h;g����cq�4���e��$�"_�ӝ�o��<�[����.v�)�r� �ȍ�l����e��m� �je�9^��tv�'v�� ������=婕]f� ϩ�.ϫ<\>��x8>�񠼰���_�?o�e��xy%��_ye�u�mr�hyue?�p�xŕ�)�׊i��������kscw�q��wl��h�a����yh}�q��a��pys�fŋ*q�\��7[�����ut�n���u֊uuq��lۊ uif[�u(�mb{քt��f��q>#s>;�� %�ׇr��i��pf�~k�g˗�������q�  9�b��� y�ׇ �7����6p�%4����m u�װ����u�� ՘cz��� �mh�m�e����:/���h�>,�xh��^�bk�{b��χv�_ �-�z_~#��b��txc�*�b;*�b�*���f���3��^�o�g�wytn�9��Ÿn�e�iզ�@��[�3���gz��w^w4�f�� �w��z�7�g #7�m0je��y�� ��y�l�t�8n�o�v_�<�wf﫷;dϧ����ql#{?����7�m���u�*�b� 2c �v�ul�ʌ83�\3��^�l/���x�9dקbwu�������� x���w���/z6ɭ8z�g���e�of, ��y��u�¶8w2�{ņ�)a��:w\��q��x)w͍�c�co�vתfv�u��]��u��"6� t1���_�t�}��x1��(o�9�w������� j ��l���x�����u4�8� x.r�e~��"��s��\��\di��"j?q��"j?qr鎶m�>=��'�������,t�z<͞�՞u� ��f����n�߳۳��k5xy�znxn{�y.x.{�y�������9ǥx&�k��=.o��3i��qe������l@�d�ɏ�wl����ɨ{��4#/�f���ni,�s=�7�(����e�ߥ�b�zd}w��*j)�jq38ޜ�"�)�s&�3���2��̣�l#ެ���l��l#>@��j-�l��3h���]6a��"^%���wl�)�b�xtxd�ȣ��dž[8h�"/�����="h)ql�t��$�l��� �$����u�qo�s��r�h�4\��fcw< %h �a��v��xs���������njo渋����ys|��j�u*��q{uoln�7����ew >��-���v{ ��ƕy����d��;�o7�g�9w��9���i��./>�ri֨���>��4�ml[�h�z�b$��h�����_&�")׽�hr�''yw��?�ƶ_�m#�mz/->��d#xb��r|�[������zr i�q�̥�����k��\o���� ,�����o���8 ���$z��n��ɛ��-���\�h4�t`𞧼����fzm䜟��-��o}r���.��y�=�8�_�����s����ِ7�[���2�8zk���;�n�[�}|�|g#�7��ξ�ӿs� ��f��y�˾kf�ã ��2ϲ�����720�;���/�;�� �m����|�|!�ߴ�3���z�\x6��o���$�_�o�؋�j�j�!�y�����m�m�m���^i}������u�}� ���������������������9c&�߰�����5�wk�e��y�ݢ��'� ϩ�wa_"�*��$�w�8kr��r�����!z�}�o<�с€701�0p���5�f�2�)��&fꋻk����_ƕ��v��s`knm`[`g`w`/�����#���s���y_&i��:vg��7�’5l �yg�ӂ����� �i`wq0'�,n���ies�$ n n � ����rz)���u������e�ݟ��>^�~�?ş�w���)�n�a/��?�_���sܹհ;v�����s�����s`w��������&�2�j���/��he07� �6��ÿ3�s)jt3h��;�����b��w�sn� ���'�g����� ������0��c@ �� $��w�\g�l������@�� ω�xgfmk�h[�*�.� q�� jɨ����(n%�k�j&{)��v�l%�v��z4^�-,�^2�di��v�����%m%ˈ�t��dmi q7�����t��$�v�������pɱ\o�ɒ3%�%�]r���\�]��zi?lbzolԣ%�)�bi�dub ��g���f�:<3���y˄d��[ji9�u��rzoi�-��q�ai�������;h���nq�t��%jw�� ڟ�oï) �5 j�\qj���$�œ���o�ĝ��������"_�|����5����t :_&�k4����s�q�o��<\�n���� ;*o�i�< �m*3@�%\/[��=(��:��a=�_yq�˧a�i��a=r�6�(l y� ��#d�����9p�����g]' �����<\�����ssn�r����u�}���"���sv�1d�;�`*�t���c�������r��)���(g�f̹���g����x3�k/���]ݷ�߿a~;��ue绝�[���27�x�ӝ�o��u�������i��}#��\w���j�nkܑ�`�;3¾�f��w�n�=���`��a7�od|������;r=�сxcvqޫ�{ �k�8� �����k�yn�bڃ�fm�q�㴹�|l���m}[߼��eū[�%���u�l;�f���u�i�]���6�ĸ�bp]�~�cug�cblu�{��i��υ��t=� �"�io2ø��� ��d_}/sh�������c*lc��;�z/�ql�i�h{��mpgpo��`)�r�uk �l"��wd�&��\��?�6��o�o���zd�as���wt�w�z#��������;�w�g����̻�������t���f��w�vm%����3�#�c&y�$��npg����g��u}����'�i��u��lm��ۻg��mr�9&����ɉe�a��������`������'�ݵqsl\�h7� �ɟ{¯݋�>���j�5t'%�b!\�6��q�f��(�j����`7�>�b�us~h��:������j�p��v�����t����>�ir 0䍐5�g�u�#"�f� t%����\����w���5���5��c�&��o�lw�k�k����i�f� �j׺�{�qm`̹f�6o�ܜ����rm'ys\���wur���gj����7�oxp�n��x�c2��p?�ސ��6 �g|�����r��x?�cx?c>���ƛ�� ������$i���n�y!��<\c0�`� �v�pa�]�[b@���r�:�u���2t�|fo�ũt���a�����oц�l��7|�[� ڻ;,�$w >��ww ��:r��xgg:�ő��p���,�m��gc��7���.:���zq�1zh��2*<�� �n��v�1�(7z�ψsfs�,7��x�!g�@�d���號���vy��3 뿐%��_˽�!���%���(����d1�2� i'ǃ��*��8(o�w ���d��m*�h���*$�%�{�1�uf��xs��"i��y�c�ғ�'������ce�q�9��e�5�>��_ԉ� ������#��x�������?�b��ic�1u ;fc��l�����k��\�ƴ� q/�"=�`�@�m�$g�(��%g�3���.�׉c���l��k]d���.;�;�?p�k\���m͉ڣu�3o�rg�9q���\ϝ����t٬c�=�nкv�~��<�t�k��v� �k���{��t�.�a��%�x����|<�߻$��"�1��o;� �c�c��;f:�.�o8�!b�9�q���y"�q�x �k��m�u�w=�[dҍ��4��iuӳnu ��|��� )��mu-j�� �s����kc�htzrz���w��� ��g���i'�ؓbi'b�o ?�풬t�%��dh�2�|i�e�6dɚ6�cz�����z�0�β���ej:&���c�cg]�!s�c�k�o��}�n�҇e� �$� ?�����6�j�s=ʏ�l��2d:� ��s��}��~,���r��e1����`�\�c2�e(�#޽*����剙���p=���wɣe�g����7~ߩ�.��*<� o�����xz,yz���$��,����7ěk}?bkiԅy���kn��i- ���,��i���[�t{ocߙ�-���g���m��[׻n��~�5>��2�#�b��$ �dhr ��_��:��x�o��9\'v��p��m&��xstk�yktk���-�f4��ne i��p*��%��4!��j�n�;���0�jh朮r�'$s�����2���#ji��ſ�.�in�e׭�,i���n����x�uj)���'gpc�d|ϲ0� $���hw�p�v�y��w��$o��o5�y�bq����d�m�f-;���.y���m~!��~��c�o�ş��"^~o~o�#��o�d��|r� ��ϐ̳�y�9�cws���ʇҩ���|��6���o�d�d�1�km�:mc�b�:�e�c�d���1�w$��f� � tu9�7z��թ^��gw��l�� ;#x�� 6e�xv%ڿͼ8) ;���j�y�f��δgh���i��x�ӟ��ή &�?����b��حp쮥�����p̾i&֘��z���1�ַm��7�o��aj��i���4����<� |b��i�g ֦�i���w�:9ƅ����,�-o�z�pj.�n�6q =ٺ�(�yۉn�v��ݺ�j� ��fj;��fof���5$�i�ĥ;q��:h�nk$4y��:l�hc���6:�h�!6vxh��� �����z�u���љ���dip�%h�c�mt�e%q�[ci%�ղ���8��6*ig�c�����ԅ�e�%��zm��i��4abq���xv������w{g� �`���5�bqe�\���o� �tp�'("r��a��0ږ�ɔru��5q��$�c�-u�� 5c9��v���v�ku�o��jr]������x�dc^2�j&� ���%p-��ҕw]�<ʽ�&��7;{~&� ��ŷ ��@� ̗/��aah��l����ah����m�-��sxy�o�w�5�����r��k��w(qj�2 �8m�kv�{��^o��w͵֓����cw�n��b��"j�|pi� q�������~���?#������� �; ��i�m����p����]�{�k�tzʹ�a��$���d����3���o���?�m-��anv��o��m�� ,�㸭u5�u@_%:��k����o�ֹ,�{�g��w�է���~��]�r� ��1����ye;=�> ��8hwak��^p�d(�����x��7�)� 3 :da�4h���f���|�����x�x�s �v��י �w9kˀ�υ��(m�����gx�via�h�3�v�¹l�x�&g���x� �tp6ce=����� �~p����p�y�f`��&/��'uۦ�ww��loؚ���9�m� ��/�����x�b�^┍�`'�)��>����e���2e�5��z-���j����5��p�,��!�((u�� �k����. �/�&e\j (�~ak�ѫ t�v_ucg�q�r���� �������á�<^ا�t?�����-f��=�wvn�~�f�_�eća����������p�3�π�f}�a���ٺ�w�g�˘� ����}ĩ�]�j����h6d� 0�cn%�zg0��s�,}��gx=�2y�n`�a���[�w��c%�|�۠�����i֊�iz��\�9j�5��s �gp�c�����ռ-^������1v��j���<���̧��t7��~�����kj|f����x:��m�,�w�u��оe�a?<x�龓hi��'u� ���bͳ���v�'i��%�˽ ��n��v飘'�ץu�%����h�� ӳ=��\��c��#92k<�� �qh)u�5�l��g[ kr6��̗v����"�'8��i�1�"���v���*�c)��vf*���w o��6p�о�6���dy�f��* tk- ��>��l�n�uz���bw��_2m��x�~����,���*��eѭ��ӗ%��6�bu,�zȶ����tg1�q�#� �!j%�'-/^b��o'7i������ ����w�����$<�x�a�����m���!���������?q�?���})o.w�u=ϭ,_���������,�o)?#�u�5 ��c:����*��b^�<�x�w~ y��lg��5�s��s�3u�h�䨨�����"��̳|��0kxxff��-�>�s��^u'�cw�j��i��s��'yt�~�k)�>����;l��dŸw@�n���ٷ��z��ce,�~��g���ty�6権���z l> gr��31�b�*0���c� ��e,����r �gi@��{�ƕz��wnh�|��}��8��t�n��8gεt����.ļ �-l%����> '��t���0n��t�w#���'q�i�^���vpr!ǃ���k���" �t��n�x�ۏs�h�(���|�o����[i����h��hv�u�q�� $l}/p2z�;��b>�?�1;�1�8��3��x(��1s�{l�t�4��\�n�?t�v*�zj �����f˰����(�������-�� ��6��&p3�� �>�l}����aj[�y �vvȱ.�0��k��yཨ�' ��dž�߃3�� \c�g��k:� ��p��8�oj~�x���$>����5��m���2��zxc���2��mï�� ��� l�fi!��@�wp��8o��cp�a�t ��� �g ���,�>3! �� �?�v�x�����)��i�e� �tp:a�� =��{��@��"��c���� �#�?�ªt�5��i}�ڨ�c~.����������y�8��1�cvl��3�s� η�_b[�v=��~��g�_ �:pg"��}��-���qa��� �g�m������b���nƴ�e�k˯� �e2c�,�<�r;ce8c��_x�3���|�^] ��o���g�m!z��m�z�@��i�q�-���q�� �t j� �#�l�p�c���� �?�v�x�����)��i�e� �tp:a�� =��{��y�%��g���epf�����������&vդ��rm��!?�r�_^ ��r~ z���ܱu`z���'��6��<�wr�̝#ĵ�lk�����ӭ�ub�!�7���k�s��}^������/8�3��>�o�����a �o5u����/s���wm�d��y�y��v��p�6 ���ӝ<��ؒ��b����&��>h�=p�b�����'�v�-(�828�@� ��y}fbh�� ���l� ���s �@?�r���t�~ xz������1�e�? ���/�34�~(�v����aem�(�f��s�/�����巠���j�1�/g���cke�����mp���¶�1��u���> ����w�u�d}����� "���f�`���y�q̀�b�"f�1`xe��qg1�8�9c�aɯ���u{�ݝ}�w���}���v�����n�:u��� m~8n�t�n0yv� d�*��m�v^�,=�'�l��s?=fz1_��ع���o/�/�z�� ��,�a�aqf�w�����*v��ci0j�]�����nx)4��s�~���  �j�^��у�n��"p�x�� �i�� <�9�0��v11w��$j��z�_������[]#���b�<䃰>�e몷[�o����|��¶ �ԃ�fܩ#��7u�r���t܋a��1��^��ם�꽡�2z;��b�i ����?�/l0ag�'`?x�%p��.�vj�@w��p�)4 �oš. �s�: �x���b!�y|u��tr[ ڽ �r��*��ui��l%x��v��?9���oa�%�������s���*�e���u�����@�'xr �x�p])��=��=a���&�c�^�i' 8 x�������[���|ȑ�ԃ�d�ۡ�'p���yp �6��h�@�i�a?� $��vb�'f �� 88��f@g ��le���|z�7p-j���j������hdvc�}�f���@[u��c��=$s����s/�n�������z0 8��1�`i088��sm�s"�j�x��k���"mǘ���?� g4��f�l���c�.�g[�i(�2�����b��i������ ��|-ܵ��qcp#89(���_�zjwa�7�{8� �|�x�.��|�8��1��k��;��)�ݭ��ӱf��j����x�gaem�7v��x�c�^h�5�jc� f�x;���qzh$#�o�� �i���d�s��4`nb�.�h#�8���`�٨{^�8��b��k�dak��m����oh��!� '\t] �&�o�~'n��i��"�~*��f¶w(-�$���it�b^p����<�/,��=[k�� ��&r �y�m�4a���=���{}�p�2�ah��j�xo�{l�o�st!�|г@�u�a��a��y��y�d�� 8!���a� qnmp^�])~�gn ��s`��\�c��ו��;e�g��b�)��g�(�le'�%�a�$zg��h� ��`��.���m1,4a&�06_�2e�h� _-g�o�s|��c9ط�$�<�g6�ᓜ�ܷtv2o�.�p:b���詝�����y��s�#��e]�����g!�!�\q�ža]g�)4��l$���#�p�(4t4�y����|������y} �z� ��2�c ������z>�rq�=r�i ���ne� ��.z_�;��p���;��w���wж���[����f���d��e�y<��.�e^��p���%kx�1<6�n��g��q^�� i��e} ը�h���:��j�è��̃�#]���a5s��d�/�� �7��nj����^�w�9�'�d�ty��g��kbը��t 0������⬊�5��ؑ3�3��-`e�����a��k�"�i�q�f�a 8wͬ�_y�bz:�h��z�����x�f;^�@q�o�e,�!������u��o�$�q�"�y����g��?��'������� rň ��o- �|(f���|�ߋ������i�e�����(�xq�3j��j���n:gbב["0's ��e� �k�_ �|"p�l�z����$����qn�c�#[�ǐ�ڪ��ҡ�;��7r�i�ҩ�y�/d����лސ1@�6�� ��1}}vy��w�a��xw��b�9�lo1��¤ab�v�gs|�g�;i���u����ء�4��ia�b�*z�3d�nbg� f)j�d�,ӯdv�/�7�������ůnig� jɶ�fׅ~��l�v����m��s����oğ��s�k˧� k��ǚ�f�|���{��.�|�o���%�{���4�7�p_���@n-�k?�6���9��:d�@�,��@i%_��hwa�p�3�� ���xux �����]2a� ��(�1 z����ߜ��g����j�y\�s�ŵ�{j��sz�^�裠sx��g�zt�����e9�j3��}u���)b���x����}�x�����6��'a���o��]9_:��q:8#�ެm1o�so����vˆ��8?�q>�ia� 0�w kcr$44pe0΋ s �j�ѭ � ��d �ܭ�� �m�]�\ ���r?� 1�j-"���t�(5�h$ȯ���ƻ��>�3��rhz w�pw�d "%��1p���웷;�!�q҅x��y ��<< ���~e���z����^�y�jd�,���qoy��յ6�cf fef����� .,"�����e`<��x!�7�u�kޒ^8��*�3v���ok��z0l���w�p��"��*y�w�r��*���u� ��!�ma�m��-$��~�hp��i� � m�������=x�� w�m h��|�^�lx�nx�o�~t2�a��ٰ�wm�rh��j_md�]!i�3 68����&�������-���h� �,hކ�z�þ(m�n�km |�cf��а�m��7�ȫ�8�tt��l$8=qz�*��|���@u��b]շ�5�n�gh��\�?��q7g�ρ`�o�w�]�� p�� j���#��(��$�a�f�e�`��0ި���{xԣ.���a�> � �wf�z���l��n�"�c���� n18o5!�bwe��7���4a��6?= �a��gt��?���q��j寧�@тg�ؿ*#hi��2�xk�j5���i��" �� b��j,��ɞ�k 쉻�]>�!i@~`��ѣ���=hh%8�rܗ��`��ʂo����. �z���x�{���}�a�{`h� y�<��nz*v>q�u�1n��;oh�^ ���n1�<0x� �qw/�$z�ȕ:c�j�������1���8��i�^� ��9� !x� ��[ixhbhq �cb��~�#�ȑ�фx2r�5z�n��⍡��o�rē�!e����y|ɥr��;b��7�e 1s:�����l���!$�q|��z��r.<|h<���f�� �d "�"�bc�நب$�x$*1.���炡�*�vl\x �|:4b`y ����u��,�'rp��8��w�?)��x�;��wh� ��b�kz,�be�2�q#^��'h�c��dr����d1����d2��l� �e��.��g��d�c� ud�ma"���ث�ئ]�we������z�a�������~����]z/l����vi�-zґ�������� ��(���e��{҄�� ҍ�r���@f�4����cv����"��9o����1ym>�ɑb�d�a�a�a3���-��1lŵ���_wsj;�� ;p�7��u�a���d��=�w>�ދ�j�>\� ��ư��.�o(��p郸�6�5�p�5�#��r�5�c�w�>��j� \� 'q]c8�k��4�.���/��$�g9���2���b��q�n'�q^稫��ҵ�����r�����fj�j:ω�n���fꔙ: j�錠�;�pv�,ud�΁����n:�’���bd.|%s^6ei�y�e��kf겙�b����kf꺙�a�n�b����1�l�h��,-�m�糔ͯ����l閹�m��)s��ߣi�_!�"r��ojk�zb#��6[i���맘��1�k�����u�xa���un��t�)���3~���� m��;q�y��\�b|�k� 8�"-���\�nr q�q-����u$s�i[��p�f��� 2s�a1|oў�#j��k�z��!��oe&�^�_ͣ�d9c j�mja-���*����*t�r�\mv�t=�/�!u�u�u���m��4�n��h&��υytͦ�t]iw�|z@��mt�e��bz���g�yz�^����\�c��>�/y�ƚ���5�c�-k�ڳ�,�}�z��,� b�,�%�l �r�d6�mfs�t6��b߳9l�����%l)����~a��z��mf�����g��1v��ae���n���>{̞����$y/ee��me;�^�$w���5�ڲ��*ד��r���#7�[ʭe?��*gȉ��,7xnr$ev,k�v)�tr�*�j-��⦘/�[i��r��@���e qz*}��@e�2d��� j�bjq�v���6�m$�j]�=�g��{�a=� ic"�t�j t"�h�t�dj��t2��s�tbigҙd���,be��gm��y�4]h��.!e��bk�?���� ��y4�����jr���kh���%�t#�h*ҭt �dwҝ�2�k�z� u�az�t���qr�����#=g�'z�^"���f��[�����hm��> ��#��Ԧo�r�>�ψ }a_��|�!�|�7֌5#�x ւ��v���|�/11�or��o�n���f��_iv�$}�qv��c'�iҟ�f��v��%�|\_ a� �b�� v� dw���{$�=b�� ��=#�� ��d�?�d��>�hv�jh�lej���@bekْ�ɥ��$^.#�!��ry� w� �d��\�$�u�*d��,;�d��\���kɵ�h��\�����u�h�mv#cdwٝ��&�d�ʞ�''{�^d��-{� r� i�[�-h��jne&ʾ�/i���}�$y�<�d��d�� '�)�k-ג���-דi��-7�� �� s���rj�l�j�"��2j�rn)g�w**�l��r��q�'2w���$��jm���*�d�r_�o( �d��xil)m���ojk�%y��)~d��vik���j{�t�t&9j�l~p�q�!�jo�7�q��'?)�j8�y� "˔(%�,w��h��_qj�nԅ֧ � :�~o�ӿѥ�g������v��g�z���g�z�ޠw�=?̅�b.�.��:�.,��d}�6� f1,�%��,��el%�g�����겝l/;����,��c��5v����'�{�޳ϲnfr)ي�c�r�i�,gˍx���ar$�e��? ��rz)�tp* ք�j=�ci��(͕�j��n�tu� �*}�p%b�����f��t�iren�#w1d-�ʀ|ed�*�|e�|e��� /y!/y#/�f^�a^*��d��ty�y��ry� �k��k��*!/uffr@f���t���#����3�mud��65�mj!��f���l�ls���� ٦�;�@}���'�@�/䁆�����|�� 4eh�<�y��@k�v���|������� �edh�<�<�y��@g�n�����b5�� ��xa�vg��@�~��퉘�1� 1�1�1�1�1�1;1�� c��#n"n#����a�����(���i4�4q:q�8�c��#n�!6�x���sgz���}mg��t]ls�ot�@��t�o�c�-��uz�ޥ��l�1���<6]ylvd]yw�-��by�bc�06��bcُl9�ck�z����]l dg� zį��ev��f����){�޲�x�dy����}�q.o�e9fn�㲿.�ܢ���(6��b�8(�j �]�t)m����f r:)ݔj/���d*���q�?*�������xl�xl�x�f<� � �"�!�#[ ["[![#}�~�g�c� �-�1����xl�x�x�x�x�x�x�h�h f$� �#{ �a �d ~�������� e �!�����h�� ��`�`bpb01���e ��u���q�%��&��!e�:�o^�o������� �f�}��n��c:}�q ��1s�b$�\ɱ�<�ck9���_hx ��4|����0 �@�xh�k0y��5�lm0s�f*�lm4s�fj�j��� _���mb�gvl$�|�q������ f�|�ė ��7t�xa�ocy��/�i~��x����w|�v r�t<�v^�^�c���`5��5o� n�xw���ubwc�q׉�eik�:�6�s'g����jہ8��1�n�]�mcp���߿p�!�_���37n�� qgi�ie� �`}�v*�s�� ���\ra�)�b�t݌��?�t)'�bg�j'�t��r2s��r%fl��������k:}n����� �cn� ���l�h"�1$�$�������r���,��a_��w���������9i��4=��vȡ�n�,���\�r�g��=_jw��{��\d�]oy��/.~tbԡ�i�u�]=||;v� o�k��lr�k�w��jrp���}i\bhrt\�����(�e��,����zx�ค��q���l�mޞ� �g��*���k6l7b��j��=;��~ь_�;t {�p����v1�k���}��f����_ عr�u�5]_�ܳ�^�t������j �����kp���k�6��c�sm���ȧ�t�%ŵ�m��m^�qۺ��i��䤦o�,x�e�'��u�t���n�loi�ׅ��x������5cþ�xa�uƚ��_9n�l;3���%π�o�e5�l"�먕�'��biz�)�lmýcj���|a�c��ħ��og� ʐb3�o{&����l�`j��t���jm�b���|�2f�ԕ� �:}�"s�� 6�o�?�jȯ�u�ݺ��%gh��oi��^2�y�)en�x��f siacy��d�l�_lu�z_^ow�ʉd�{͋��;-������s��(.���0��*t�c����zybg��ܞ���_��9��ܑ��#��f��my%��|�]�}kw��{���?y�uh�9�-�k zͽp��j��ϟ,k\5�of�cvx=3em��7��*����ŷ�v�w����ug�\���f���{�m��ᾃ���::r����3����6)�ߜ��{cl�[����8g�>���;�7y�� j~��2���4uh��o���*���€�� 5x�tan����z��?�|4��ݦ�����������~�;��dm����|��y��sl��cbu'[ ��:��3��� lj�ƞ�^&o�p���y�$��c�u�u����w���oޕ�n}���p�;��������i��gng����p��l�q����֯��o��<{�����w� �r����v�֏���s��o�����ٿw}p�p�^!n/�ϝ��r��������[�=~z��'�g�yw?o��acș�%��z��v�|��s�;��ݏ��&z&4�zr��@�n�#w��ˁz>q]:-�o�qo�������r˵jyz,�;�3�>kx���f�!� ;�!5��\ ��s����a���n#�|���ms��n۹ۡ�oz4���cv�m��y�k��}�o�g� �5���s�q�#kg�ߴ�٤�ǟ��l����.�o���c_9y�ёc�b�\{q}�҉'��aj<�͞lc������'�o���j�7��=�!�dbj����5;��h2����bfc�ᇭv�)��\�$&v���-f��fݿng����g&vru�38`����6]ֽ�xif�ӛ ��ͅi֯ӓ��{l���d4��nn����='͍-��x,n���!���ʌv�m���h���8��7f;6r)meqn'�0�dw�s��[���g�ڱ�᪦�� o�*� �iz�� &��*ď�����?m��"a��x�c_j��e25�g��|���e)v�dk��io|���c��365�|���7���t9�5.��:�y�ah��6g�_�,��0���g��� x:�̱�2���]�x������&o=���i{���כ.z_91�i�� lcf�^�/"hq�z�l ��`و���o��ؤsax��|�ܙ��o���n3n��y/i~�ǵ���d��>��e�4g=�u�-�z'4%�e��e��%�ɫ�y�[~ku�|�����{/��{�(m�sfcyh�յ"�m�߀�*`5 �=ֿ�k2�]��3��ɯo 2���fd,�k�aa�d�ehe(fp`���@:�!(�ȑd{2�y9@u� �tp�ւʂ���ă�j���� ��2���p����ak�ev�cv�oq�`�d�1���ӥ���9ί�z����^�7d�ŋ�w^�m�}�����y�?���ݾw��biێ�/k��/ͽ`�����r�ɏ��7��y$��tg�'�x�b���^s�0�hs}��ܽ�߹ke?� s\��r���o'm,wv��!c����lۆ�[�=�:�������s�?;i��m!tˑ�x��e���o��d6����7�i���߶��ym��i�1�f�i����q�nօ���m4������[��~��&&y�&&id<�61��8� � i���� �h �fn��/#�n� �!?�n50�421�053���h�3v��������=�-r�.��vb��h��͉�ϝ�\�}���9v�����l���?�f�\o�3�~ף��>�qp�[���}�7���^4lէl��t�۠�7��wn�7b_(s�=t?�.z��f���)�yw�^� �6�[���b�j� ����irߓ��e���u����봙����v1\^��z����m/<�(�9q#u�/v��a|�����-9��s]{��4 ����m6�;f�q9��7�����r�g%u��*�[��ۣ9;�;�>�}��>���:p�wk/��� a�3bs"� endstream endobj 903 0 obj [ 0[ 778] 3[ 250] 8[ 833] 16[ 333] 18[ 278 500 500 500 500 500 500 500 500 500 500 278] 36[ 722 667 667 722] 42[ 722] 44[ 333] 50[ 722 556] 53[ 667] 57[ 722] 165[ 549] 401[ 604] ] endobj 904 0 obj [ 250 0 0 0 0 833 0 0 0 0 0 0 0 333 0 0 500 500 500 500 500 500 500 0 500 0 0 0 0 0 0 0 0 722 667 667 722 0 0 722 0 333 0 0 0 0 0 722 556 0 667] endobj 905 0 obj [ 250] endobj 906 0 obj <> stream x�mq�j�0�� ���d !�!8 ��u���v�$d�࿯$;i)]�`���v����}uf4�wz:��� ��i��t¯(�bl-�a�̓dzֽ!e�-4'�f������'�)=��jn��~��#e ���sk���&ٶ����� ���l�ea$n��z= )x��k��������z�ٺ���x�ʈ�cb�cү�즹y�si�|jl�v����-�}�����p��"� �΅r�i��x�klt�� /�l endstream endobj 907 0 obj <> stream x�� @\����}o�}`�����-&�5�$&bvh k5�����-zl�w��k���ab�dqs�ڪq[��zmzs��%�m����� !���������s�߻��{�w#��#\ddnus}텞�ww��$wwv�<��=��v!�օ3���{����l �_y[u]��g�� ��&�z;gv��6z !w�i���6�*yq�i• �ykv�'��hb��j���=��ki�m^v�������^ho��g��{>�|��b�� :�z��ء}�ot �y�����ab��bzzewg�׷_�կ� w�b�u���?��r�� -���� q�pvw﹜[� ��n�~n����s �yw�i���ゞu��p�o��v��z���ǐ�*b� {��ք�d3!7e�=�]=i{b�����0ۊ� ��r�hˎ�8aa������.��ɷf��?�> y�#����zp���['6�?j�ds�f�aڈ�,ሎxh;!�.h��t^4��)2���<�2 ɿj�rdf8���e"�!\�k a��46[��j�x� ��sz ����b {r�]s�7��*��h��m����ns2l��׃��4��}� �~��$��}� �a2l��0�s�����/��� �w_�o ��d�݇� �9�%̩?p?j@ni񁤀����4���t�p��v��zߛ!��[��ur�}�e2l��0&�d� �a2l��0&�d� �a2l��0&���$�����o�x\$��b<сfwj�l�mjh-i$���l�v�bb)5� i�g���qbd>��:����e� ���=�g� �d�}~�_b� �� g�;� �a��g�| �'��)����������?�u�n���/�?�3�ߑ�埩�a�;y���u�y�x����z}-�s��̞�8�af}]mmu���iފ�esjk�� <��4�#şl1�:�z��ˤ���(ɬ�״[��v��i���bq{(:&(��vp՜��om�yo�酜����ŝ��tg-#ey��j����n ��m�p����f����½�)d��٠��ڴ�����j�� �۫��!�b�}z�" � )�p��;��g���s�k�.�l͚���n�����*���&��t�.�d�_*�e]��l��e�ԑ��.u���ca���b|����~�˟n��?j�g��gګ��.;t�0w��;tv��q���|r��#��8t� �e�8n&h������fc}�:�%k!���ԋq yj������yʁh���r6erƌ��m�u�����w����z�2��¯~!����k��d���wu��zz��*��v���z(��;��!v134��=���^�@ae>x��* ���i��p)������z=�^�duٛz���б�|�yg�'m�����g�@k�r���� �s���l�{��|m�֮6�%�ο~�� - ������̞\�y[93�ƽ k \�e��w q���2k 5�h6h%��ݝvdx��:�ij���̶6���9�'��/�p��}�v�a�07�p����jbo�t�`��o�'�lnjș;�"i�f.�8�fp1/��~2��jﲷ�a y紲gc����loh��*x;��&�f�ň ��"�#�!.@�e���g�a�!z�!z݁����ոsg#~�x�x�x�x��bt"�!�":�%�ňe�������@\�qb‡ha4#�"�s������� d=�q��at#����i/�q���(cla�"j�@1�q�(@�#���d��ln�yp�fd!2.d"��he8�@�@ ��e:9[ ��ҋ� ������c����[0` ѩ�b�:��a�*��@ȱnb�j b�!x��"��c�q�7�����!���zh��ex"z�_!�d|��q ��s���lj�">@��{?c� q4����c ��đ@�t��1u�w� ~��������-�m��7�7��ױ�è����~��^e��xq��e,�v�k�/���#���� �tb�g�����?�� �b<�x����ރu��dz�݈]�alh'"��f���ǰ�g� # aݥ? �d<06~0��0��0��0z�`��ef��܅i?��wb��y;�6,p ▀q�f,~�f� إ�1�u��z�5c` �܂�10�~0�� � 6 3w �c�e��r�r�w����rd5��4��a�<��g � ��av�<�(�# � �<�3�a�)�� ��� r�v�m w vz���6�[an��&�an��:�j˵ ׀l�2m�}ý �; \i,tc �mnjqlh�a��lh�"�c� ��"v#�a���� 1%�c(e� �e�bd"��� h�8�ad#�z��eh�8%hu%b��#di@�\-�.~ 2� �� �|��=ȼ ���m��@~ ny�7 o�<�d�^���? �mh��=���8 �"�g�#�#*��^d�1و0 ���<������92 r�� ��bd3z}.�� 111 ш��h@�@�#���d5� ���a� " ��h@��8� 3�8 � �i� ��k���� �k�� ����}�?�y� �y �e�@~ � ��a�y� �3 a����av� ����y�eo@\�x��v��d�@�,gt!:�k�v��b�"�b��|d�qb‡haxn4u"�bd �i�t��@ߤ �1b����$�{�!�1���o��r�5�_�� �u�w@^c���wx.�ݖ˨�ri�&�%��|�6�.��sn���a��`\�ap��$խ�]8��'zox�)�խ�]0�֧\ku����z������[�;��������������ot�m���sh�h?�2��_��ys������z�{�)_��#����sz�{9ȵ�7%���.草���f�z{���}=�ݾ������u?�-��}m7��8o�\]sn�j��ws�� �.����1b�gܘ7d�� �ʽ·rp�o����5��[�^��p�����.�-t��-��ks��΂���->�`�����;�����fw�o�`�o���w?x�sgk�5�j��o��=i���%���=�\o��c�|o±n��j�7�_�k���%�wmܶ�qb�pëz�6eq=�mz.[�տ�?��v=��v�m�c���.�~� ie;�t��)� ~�f��[�k5,��wn�vmq{k=j�̣�p�v�ת�w�έ�srk*t�ukt�6����5�)b ϋ����!9�s�s ���� |3l��� ʾ�j�#-���44��/���o��;����4�/��o|��qzm�妷� �sc!~�֭$�������oo�lk�ob�^�pb���������q�����4k��w� � ky�g ������_��׿��p� j[,d�gu�g�?|��d�?d��ӓńh�&d�� _c_??!�d�k~n^ ��/���� �s�=�����y)�f�@���oȿ �]&^m��"!���n�>{(�!l�͍�9oibq��3uc7��^�(�n(��^�1::�u�x��ź ٽp���c�n�n�%�����'� �b��\f6� �u��`��p5�b��kȵ�:r=���hn"7�[ȭ�6r;��� v���m���x�n��ehe)���c��}�~�s� ���?bj0�(h��{@�hy.��?~2dd'�a< �d7y�����'o�'����o :����qn�>c�g�s�y� �k/���!�2y�_jyv\�b��_�_�x;l^'o�ߐߒ�ɻ����#��o�.�m���y'����o�c�991������p�a({��2r�r�$ ���-��n�ȼǽs�`g�gzp�7������#�� �x0b�o���a�cf �r(l��þ`�<9^�e!- �{z��s�'|}�u~7��"� �a�a�)�g!�2��t��ʢ�yy��x����au�,������ɟ���n!����q�z�|�ɗ� ��4� ���35_��_��� ��7dtbl�q2>� �(o�nݝ� "�b*�5mf�tautm5t ��)���ߥ��%m.h�h45�zkm4��a�l�i�bm4ybz�x�r�4�:�i1bɸ��;!o:ͦk��n���o h-m�s!^ i� ����cn�?�^�� �� �.����oê�))!�di�o��.xvk��uu�,�刕�hd`����"nm6w� $[�&}}�t �b*f�}�9��*���wf�э>�/��ɦz�^���j%{�� hu���s�n{��t��e�|^n�"�r��)��7����n�mjs�����h���$�yvmc��0-^,�ix�l�zxi������”���jr��o�5'�kn�%�:������vj�l�!��f��� ����#����wũ����;oq v=8��l���fr��h��efc8��hoov ���g�z�f4�u"0�\-w��_ѻ��sj�������ǣ b�fnw���i� v�y��������2��ʬu'f�)r2r��}�����r��ff&8c���at4) >��h{��;��-��9�� [c'$��.#�e/x����x�g�6��\�pj�j����ijas�ji�g����cdžuvnfx�kew�:vu�5֓��xқ,�(��ց[��p`���� �9<���ӱ��d�'/o������>pd&��n5<�k�v��2�ͣ$.��q�<��(9o���h�npqc?ey����-q��-�2��dea�#��l���d4ymi/v �s��) �b"��(��q�^���:�(��{��k� ����ofy�q���@)��� ���`7�u�f�d@i.���v�x�^�"�v�,i5�4��@��z��4#_���j�3���8�[t��>�[�����:&z� � �5&v^b���yj��se�k sz�5-ny}���[���ް�a}3�l{�pyan���^���whmvj"�b�\6c���;��}rs��)l��h�:�h~u]�ܮ��5�j������^ ;�}�oh�a� 9�a�ݫ"�z�e�q�j^�&��6��m�*��n��zo�1��dx�%�q���aap���ϙ�� �)l��k�}"�z!3�%e3�rt��'���kf��^^\��n���b�7���r�t�r�9zx�u��p�/��u�nsjy�\�2f��y?�9g� ����~����kv �s���tt��2 �d�c��t0��w��"���s�x�� --ߢ�m���ev��z��^hsӟe��oq��:z}rvzq�v�\��qb���f����>@ӈ��r~&�8���0h���}`zk�w���{�"oe�bo���n�-���9 t`�$���fg����p.<��"0�hm*���{fnl�7� r�ʜi�f�c�� �xs�q����_���)x:1lz�ش�uf#��f����'u�(��=df���z��̠�� 78�jhp��.�s������dtt˫j#ӯ4h�wfg���]c�ipi�w�v%��*�!�w�$�r����j����� �ϝ�e.�.耖��z�b�1.�1"b��8q��vc����=�jٚ���o^z��h]�.�q���ҭ��9^�q�����m=5vs2}v��-mccqi�����l��s�qw�mկ��u���ܻ`�ۯ_�k�ժ��%=v�֩�v\5s�`pv^ӓ�x`vd�iξ�ş\���f}��'i%e��&e��q��ʳ�<��]t�a%6�[��������/��eg*\��1����r�\-m��^ [�c �!��ፆ���n]��;���b۴�����ie��?��ۗz,�s�w���5�*\-s��5����� ��kܱ]�k;�ց%9�� me����i� gm\��n���ͩm��5/�ڋs �u��lw�k��n������ܢ��ys[�zq�~<m\������~΢�������\j�*1�o����-0[�&�:c:�7 ^qdk'l�qߢ?�� ����3���7�ŋ���joshx��&�ye������ǖ�睷�� v,o�za�d'oi̊����o-�j��r[�<�_�`���qr�c �������y��v�����&�/��ű�mv���jy:��qy*��v6��_��f�10v�;�lj}0��.p꣣�t�wn����q�xǿt�jz���r f�d�:t0o�k��0��^szm�v&4�z����f�"����1x�nhna�]��%ʨ�d~�r#-�i�1�}�jl�^��4*#֚r-n�i��\�w&���p�q�3��b}��d��ȇeb��r���kjs*؎�wd�a��ө��4�l*�)[j�%t� �ǣ���ow�9�����>%��g8,�0l��[�[_\b��|�z�u��h�ͺa��/�ƭ��e�dp`d7���5r�-?���o�ѣo��j��-�zj虎)��ia�]ݒ�ufʎb`hxݎ�b��dg82}�[ol/ϙ��� g"���(�/=��ukg�i�@�tl�wi�nl�w�b3�6��n�����t-mu�tu&�tm�p��~k�����[do��k�j�v���o|2�s k �s�էj�v��$*����������u�ɫs�t�c���az]�w�q�d�4γj�8���g�j����9��]>�(�7����5��|���b*.8ma- r�]i�i��ľ�aa'x�$l�;���g}g �i�k�6 �1m��a����v8���0ϣ3 if wexe��fn_5om%|���9��}^!|p��� ��vž޲s��a�-��d�����k�t�$y�ח.�h��$s]rv�1��۫����.�����ye��xmt�3�}��k*�s�ݐ�jl�r��xwry���".g�v e�@���05� ����#��b=u�"�q� /�h��} d�x��3���酡ߤ� mw.�w�"�ׄ�����w�?c���o�e�6�38~�h���͓d'��'r2����q���7�2i��m�.�-��z'��x=�eqy� a^�m�� � ���p��o��%�t�7#�ҫ�9��&�[���d�!��ns�ܺ�^a�x�4m��*�8�2�����"鼉}�`8r�lⱰ ���������� g���x|g�ƅ��(|6�e?jeά�o>��ty�7�\�����(x��̊99-k�9��- ���^��p�� ;�9�c'm�uٞ�����jo� ����{�j�*�`lk���h5q���g$� �߰�㾵�����;��������4�ۙ7<�ϸ��mpfh%��������w��ۦ�h�.��t�\�|pr��[z�c�s�f���9�ު����������t�4s�3n��w�%:c�~�����m54lx�w�p���������|v�>6��а;�.��8�i�~�����b'&t��j�ng!.�11�h���hk��j�yt�p/�?� xtչ�מ��= � r�k@q"d�*׈@oeb ��ɐ�q/�-u��hse�a�����"h�k*q��c�����k�=��s������{�=k�ַ�˺mpp;��n��s�d��<�d�[���w�����|�my@~z��{ﰱg�j��r����x.��5����b�!�!�y��ȋ�r9��bl[l[���=ס9��y���{��^�������9j�?��������������)�ϕ�����j^�vm��c߯-�n��x��k�]�����s��wʷ�)_nu���������gp=)tv�l?r��4�'�jc12���r��b�r��b���:���6�7�*_�xǣm�.�tb��od\zud��rw��p<f̌����ŧ_%*�3t�v��z$�v��^��>]���ټti r"*�f���[f��?_�/�7�t�a~o�����4�a�,�mw�m�!�02�g)g����� 6�s�$g�?�|�yf��3��� d�ds����j4 �ھ��x���!eg��ҧ9���u��8����r4�����j<��e�hsq�k�<��fշd�!�x:��$]ͳ��k7��q�r��� ��(�t�������s9� ����mu>#'�2^�, ��]���ۯ|��"_e�@�#_�u����mb~_g� ��1�t��i�<��ޕ�����k�˶�d�\�0/>��t��ن��v�<-6g�� _]��9�oyo��4z�l��0#���yu|��s�q���j�7׺��;�ݚs���t���������xyc{g0���u�x�g9���v15v��jxe���� w=�ԛ �ɏ�- լ��2�?5/z��@e���n��ru**^�ʸ�j�؂�`iy�̐���`ii0'tpr���?�`��p�b~y~0���~cna��`���̟�/*����r��������)*(����f���g� �����⼂�ye�����y���- �������3�sb���20?��_��e��ee9x��sjyv)*/ �����(?h˲��rp�/ �`�4텅%���1�_pt����c�,������w����(��/ �w��\0'?�o�yi��(�8��-�y���lޟ?����`n�1��_^*_��y<) �o�p ��k9�y9�"�]2̹�s��l��~h���k �&��_�>�j����]�c�������鋴�5���z�|�[b� ���ǔ�������o���f�b�c�7o^zq�_:��"�%��9��#sc3k�cefsy������vsk� n�_^���1hv�s�e~�� ���ψ(�n�4�:j��l�9�7� wv��|���ѕ�������` ri�_j���]rlj� ���f�n���c��j�j.% *  r���01]ôi��� ggp�yņ%9m_��9�� �%ʋp*-�pan�l3;���4��%*��g�0 �s�j b�n��"������e��e�p�:w��mdh�_p ��s��kmw{�m�ϵ}b�j�并on��-��k�n�t�5�ھsg���<���g�kտ%��{�l/��vq�2؍|��!zkk�@� ������8�a����â��7��zdn�t�x��.]/���kng�;55�nق���s��.�p9�^o�~*�6ao8�|sy4��e[7��΋�ɏ�-�b���t5k�^���tx�k�fq7��w55'zkk\�w^℟��t�kd��k�9cŋ�����rj.�𜚚�6�wy4w�~���k�ds`�kng��-���0]�q[4wbmg5 ��4�c&r���vk��3���ψ3��i�s�������p9vg�l�4�����*�u���o�[�=�*���=ʡ�u�ed��g\w�vjn��e��l߾a��n��n�sz����r�gl�؄x��e�'ܲiӧ��#as�n(�=��c�@xt ��vv�~�k��hƒ#f$�3k��e,zzⷕ �kh,o{fenii�z�mkkm�w-��� ��|ڢ4�^s��[y���-a{�w'�����4v}">�d�xs~������k�x����t��^��꭪ϫu] <��'yo��#g�ߺr��� �my7��м����i����x����b��b�u1r��c=v�� q2���0�� �2'�i���j��m�n����s�r��>�2�"�ɼoi��b��u���ȵ��� <��@cm��xx�c}��t$c�׭y�t-� ���z��]�d�fq�u�$��yo�==�d�j(l(�#�ݥ�.����mtj�n ?��߰a��e�\ �� zm�œ��6akh��j��:5�;k��.5,�rr*n�d�]w������{`�n�h��-;�z`�2����٢�b���o�u m{�df�ԃ��� �*��ڰa_�jny�-'�i›t��%��l��[x �[�[r�� ���y�kn$x(|���s��œp�c�v����"e��3l�\�"q��;m8d�語o,�ɢb�5;�qф�c�"c��~1�l#ϐ���!�� �s\�mx�9sͻ�����ҳrq��/��zu����i]ߞ�g�nsם�����q�}�zp~���u��kumw���u���u4�h��p]���2u}l]w����.~�gw��n"i%v"�����g��o&�^"]lp�%����9�x[| ��1�"\�s���a!� @���o��œw����;�ϧ�lӈ�g�{-!��޾��������.��{���_xz}�g���_#\�6� ��ۅv�k��o���fl��l�i�ͻ�*ò-y�-q�}����i ٞ&�?�yݷ�s�?��h�{�nޛ,7x��d���9qq�r�;i�$�僤o���4 �l����g������m�ss6�e'��kod02�s��钸9驤u����d�vr�l���yt\w^�#�t�vic�} ��*ct�i���������cd����i��n�n��/6��6�b��g���'c��k��muv�v2��l/u�u�ۤdg\�޻s���k�k]��f���sםm ��hm2%�*�-�'ջ�$?�'=.#����s�db}��d�ž/��s'����?]�yɗi㐼�=������~��q)}�/[�n�dkg�u�{郐�� \nʫ����qŧ��\�� �2nha���|=󽡽��c�öd5k���uj��k� sv]�%� �7����_! ��������m#�m7g_si���hu�%�ݭ�g� �%���nr�9z���˘�1�gg)e#3nj���yc��6��9n�2�o?ql6����_�mw�?{��@v1� ��ͮ�>��p۴����؄nvѯ?u�f‰��g�^8i�o�r���?z�gճ��0{�����f�t�q��xui�\1w���ܻ���;w�ܷ�~>���a{���>�<\֩쒲ҳ�e��6�� m ��sޣ|g��pfxf�"�d��y=�m��j�슇 ^��v�'�􌌌,�l�����gϟ?���篟��ݾ�g޽��w��[zej�ʼ�u�_.� �`݂= {-��.�_�[4mњe��zv��=����w���n��"w�{�z�xk�g��:}ε�)�x?��[��h�u���"ׇ{�oce��i��m�w�"�����vc����y ��iouz��9�zv^����>sd���i����f�x�����h�3�x��s�*˶;e�jof��w��?e��j�f�[��n%���������{�s��3������~���/���j���s~4���5f�x���x��<�*�ʬm������ʥ���[3�g$zd}��٩mܟ1xw�ymϲƶ]s�\o�u{�g� :"�v�5�'#�^�g�d_�6~b�c's��z�o�w�t��;olg�ҭkk��c�g����][d z��� k����d�u閸96nszp��7���bu����m�ti��?c;h|e���e�\qƞyg�쑾�/ԟ4�p�,������]6do����3r��1}��q2�2.)پ*�kd������u]���ڝ��*c<ȼ� u�ž/�����.�d�dmd�jǝ������}����b��m��e�rf���s���s��.�=rz������������9���q�6rf��y��ȑnd���35�c��m�8��j�syͣ��|��s�t�t�'y��t#ﮩ���n ����dq���o)�==�j[@�����u��/�oݼ���ϐg-y�r���$�s���?c�df"� y"s'4�:�!�==� ���4�z>�9� �/e$n;f�!�yy����c��fu޳h]������|��n6�]�ѷy�꿶n��)"���[�}�����kp���i�~�q���p�a�����z�y��7k�g���|�4-o���^����ӭ�z�����6���h�l[��w�vg���'zp?�����~�� ��/({<�^��^�j�-���ºw���`�b ����`��o�1k�����za�z4�"y\):�pq�y�χ�p��!�*�0̃ �� w��q� ���}"u,��a <�c�0�����:����h�h�-2��`��@��6��x<�:ydy�^�t(��exz��c�o��=�o���g��j�;�c�����c�>�]"5��ސ�gߘ�%�|��� �j{_>�گ�po�a1�@���bc'6vbc�����ȴ���÷"��otw\�e�#3`.!up#�rx��ge�c-���0��p �b�̅<ȇr��%d��'���{�q�v�d���ʨ�̨��h��h�h���6��6�і�h���5��뭓 ?�_b�lb�<����m�i�^���mݧ��z@�v�l?�����yq��j�:���? ���z���z]����^k��im���2-�h�bk�9'�`�~4ݎ�gв���(o�j)��3:���4m��:z��s���虆��z�������o�����/�ee��e�=jmҏb�;�/�ys_�36�͌��a��3�cz�b�՟f�z�f�n��� q�~p,��a <�c�0���f��x��v�ۡ� �� b��[�n���a�������?�蟉(�f�n���3�o�)���`���hju�g������l��π�l�@?h�;�c�����c�>�]�~�v���� ���78g�|q�[ ���.z�c�~�q���0n��1��i0��;�n}�c�~��0���|!dyt@��j>����p~ȃ�|.�����sx g�3<�r5嵔_���#9r�#9r|��8>r� gr�؃��a�#��#�w�5��c�����7ta�q8qڒ;g3ͽ�9s!�ɗe,>2urx�2�1�{%p�g��ۿ�q�`�.z ����fff=#���y�ȭgd�32�����zff=#��ֻi�i�i�i�i�i�e1͌�ffl3#���m�}{�?b&�� � k�����qsϩ�g��3j�5���zfm=���qsϩ�g�ԓ�f2�l&��b=y�'s�d���փ�f2�l���j=٨'꧈�)�~���"꧈�a�z��6�f"�l�b3q�'��d�^�ح�a,3��v�ާ�{wz�ąֿ�.vv��f|?s�}�������vȳ���>�c���o��'}�>�i���}��>�c����=� {0gw3gw3gw3gw1g�3g�3g�3g�3g���&3g�����f�l#s�|��ni��c�ӄ��c�ӄ���5 e���^�>�c���w��;}�>�n{�������c���w��;}�>�b#s�����\���;μ�͜�͜kd������|�o>�5s������փ�����c��f��f��f��f��b��b�g�g�kf�kf�72�w3�3��}�>�?���lm��q���mni�x�'�wm�w�������o�}�1?��ef��c�1�ïh��v �����e��h_�4����w}��o����yz.�e-���w�s�9/)mwp?��m��1r=��r�,���������iq��6��%s��p%p s!!xx ��5ןb����*��� 1��4q�� frvlf��qvl�~��nv_��knfvzn�g7n��rg���b�ƹ��m�s����_��>7 �j��bb�}��nlw�9]��>z��飧��>z��飧��>z��9����s=�s=��l�dz&�3����l�g2=��l�m��g�;��t敌���p�h5��7���6���d���������r����f����.�d�����b������b?� ��h����� �õp �l���0ȃk`8\ #�:�n��& 7�-p ���0��8o�m�/�)x��jx��_b5� ��` �/�z�5�;���a=���o�5��� i���wio�x6�&����k�a-l��a 牭� �3o�1r��w�6���6�����fx��vv�m�]�o�7%��� ]�t�h��� o�mvb`_��?�c������� |�)�������bo��:~�79z��� �o��\�%��b�v_�g���r��� c���s���ӣ�uz� `8�n��! ��t�.p��&gw��!r��=�����~'�;/���.���lĺ� ���o( �� 7�t�7�ϙ�͢�l(��� `!,�*���翤� �_��r���kp�g���.mor��<�ޅ���a��1t�y-v�a��np�<����zg���b7�)� =a��c��� �7��b�.�4֚��.��0�a d��0���p%\c ���0 ��������p����& 7�-p ���0�?y0�c�~@� &��0&��d�!l���_�"��{�^������o�r���< ?��sx �'y3o�*xvó����w�<�k�e`7��¯��a� ��x~�a k�[�6l�w`#� �a-l��a�~�u�0��av�ì��j�����g����g�jdcų���x�l�x6v< ���ɗgcų���x�l�x�u�!�˰^�w�7������ ��ބ�@ �o�x��d�6�.�: w�o$%t�n�r u$ٗ��?a�)��(���۟n;9`5;l_m��e6۱َ�vvi����z�^;������������׎�v�c'��a����l���o��� �c�h����|ó� �^ϳ�������c������5僔9c�9c��|s���1��p���[��#i?�h�n�r���t��co��p;z���k8^ i�.�� >�����c`�~ؑ%���䴂 �p� ��/$b$c'� ]�<� �� t����η��"`�;����n����ep1��8/���� �r ���y�;s� �@�\��c(��<������7u?霎m3��e��pw�t�� ��`�]�����>�< �a�c|�d��$�^@�x���`-ϣ�;n�s�i���4�v9y�����gg��'�y��ؕ\�y���!w�)#)g�y�z�y٤�e�?_����op��h�ܢo�����n�[-u�ߒ�� �!�~˵|ޢ�ܪo����z�8q��d��=e��p~���ǰ~�ৰ�g�g�~�����'��< ��x ��s�k���y/�� �6[��mx�? ���� ��?j��χ��,럱n�y�����]opo���o��� �j!�q|��[ߢ�ŷ(�e�-�oq|��[ߢ�ŷ(�e�-�oq|��[ߢ�ŷ(�e�-�oq|��[ߢ�ŷ�g���g4���0�c6ܦ��qr8d�� 5xt�7��".������r���%��!����o#������z|_���^���^���^���pg�n������z�ůz�ůz�ůz�ב�0c�>2ƾ���������1�4ai�ur˷؛l~�`~�`�����u��u뚰� 뚰� 뚰��̄�l�̄�l�̄�l�̄�l�̄�l�̄�l�̄�l�̄�l�̄�l�̄�l�̄�l�̄�l�̄�l�̄�l�̄�l�4�&"�d��@h"md��̄� d!@�b;q���[d����s�v:�^�5�c_a��}u���8@������j;��n4���dc*јj4���d#@4d#@4d#@4d#@4d#@4d#@4d#@4d#@4d#@4d#@4d#@4d#@4d#@4d#@4d#@4dc*јj4���dc*јj4���d# ���x����<%xx�h%f��w�m��#��@���k�� ������� �_��u�_��u�_��u�q�u�q�u�q�u�q�u̕"�~�;&xnc�na� `���5nb�����el�[���h��[�穄�a���}��%���am��6zx=���fk�������am��.zx=���e뢇u�ú�a]lr�<�y��헴=�od�72�����y��������f�n#s�ۣ���(�g�=��ql�b{ۣ���(�g�=��ql�b{ۣ���(�g�=��ql�b{ۣ���(�g�=��ql�b{��5e��h7�7�k���s1�������d��l4��f�~l� �f1s�x��lq�m��'r�'c�d�/��/��/��/��/��/��/��/��/��/��/��/��/��/��/��/��/�ŕx!7[��vk��f~��a>3� 3`/��oz�i?<�'��d��'w[��vr���m%w[�*�w���u�"x��^e�*�w���u�"x��^e�*�w���u�"x��^e�*�w���u�"x��^e�*�<���q&^|��� �� ���o-���ww|�j���s�?��s�?��s �rrf��x��'�?��c���-��f�q�v��ŷ� �e���%�ey�ޜ�-��n��<b���|� ?�^p��b� y�3�/q�'u}�{��3�. �n�x�ec1f�z�5��r�6$ml4mr�ilڠ5j�o��q��5bʒ@vq⸲�2$ �\23�3�v�eքo�3!��>z�x�g���\�7����~nߑ]�]���8��<|��\���"\�)� �7�r����i�awc=��i!1-t���� tw����kc�w/���qux����:̈>��>,k�r��!���;p'� ��o�؄z�d �ќ���1�h�^��=x/��>�}���8���clø�1 c�4�i�0{bx3�$|�§��9n�g��k�>� �<��i�q&��wq6&�����=�� p!���p1�`*.��� �㊰*j��mt�bbnx[,�o���ѩ\�q���h��q*:n�*��)�;���tt��s�a*:l��5�ר_�~��5�ר_�~��5�ר_�~��5�ר_�~��5�ר_�~��5�ר_�~����2���}|_�)�2��sq&9ǚ8 ��٘�sp.���p>.���>hc�ukԭq�f�ukԭq���n����ubxf4�ڛ����qt!�;h�!� ��һ@�b� �:�w���a���.�����̇�|x͇jb��y{�"�ȁ-2`�\z�6�£nu�h5�v�h5�v�h5�v�g<��q�:x���u�g<��q�:x���u�g<��q�:x���u�gxt�q�gxt�qa�l�!�e�v�]�l�!�e�v�]�l�!�e�v�]�l�!�e�v��ǫy��ǫy��ǫy��ǫy����<��q7��y���nw���<��q7��y���nw���<��q7��y���nwg�9x�`��5~/�b�s8w�\̹�s1������%� s����{�qzvx���8����8����98$n��x�b��e.��x�b��e.��x�b��e.��x�b��e.��x�b��e.��x�b��e.��x�b��e.��x�b��e.��x�r̥�k1�b.�\��s)�r̥�k1�b.�\��s)�r�ke.��t�r�ke.��t�r�k%.��t�r�k%.��t�r�k%.��t�r�k%.��t�r�k%.��t�r�k%.���qi�kíl�e�sa� c�@}�4d�!�qw��c���0u��;l�a�sw������0u��;l�a�sw������0u��;l�a�sw������0u��3d�!� qg�:c���p�q�adeq������-vqk#~ܽ�sq���fd܈��q#2ndƍȸ7"�fh=b�z��z��#����gh=b�z��z��#����gh=b�z��z��#���ht6��h����^����( �������0k�߮���&�d����<����ǐ>~��}���g?���ǐ>~��}���g?���ǐ>~��}���g?�(x�`��e �)x�`��e ֳ�(���(���(���(���(���(���(���(���p�p�c8t�p�c8t�p�c8t�p�c8t�p�c8t�p�c�f���j7e'�s��rq̒�/����l™8 ��٘ �[c���x�ʋ5���l�ek,[cyl=��\ �f�ek,�q/����3e_so�>���w9bv�č=c_/^o��v��,����ї)w�\�1�o�u����&u�f����zw�}��t;��{� �ewutwewutwewutw)_�|���w(_�|���w(_�|���w(_�|���w(_�|���w(_�|���w(_}u�w}u�w}u�w}u�w�� g93șa� rf�3���� g93șa� rf�3���� g93șa� rf�3����nj�~g�g�ƾ�n�kog_�mm{�w�_u/��81��%���o��rq昔�1����z�k��%���zj�{c"�е��=t��k]{��c���е��=t��k]{��c���е��=t��k]{��c�����������������������ҽd��kt/ѽd��kt/ѽ���t�{?����o�~��ӽ���t�{?����o�~��ӽ���t�{?����o����u�h�v�wb�h�/%^� ”����p�ebg�9� ��l ��g���q���q������}ɿ�2{���fn���s2�ѿ� �"'^��2mgv{�5���d����}�������q�(�&[0z���g{������iak�c����j�pz/�h�vj���wz�j�w�jl�ޭ޻ 3a��z����ݞ�����c~n}����3a��_��~�������7����w�o@�㶅��!� �m�b�m_쇃�!��s� m�z��n�m����9���x�z���x�6u�q5o��ƨv�t=?���1>�ۓ�%���}}�z��� �q[c� ln/�g|�x���z|�ˊ���m>u�o�|�7�����te$ ��!q4 �j��ߵw��~q�/*�ee���5q 5�p u�p c"ah$ ���c"��c��rkh�/e���6�o�[����`ux��ox'���b�� �_p�b�^?*�s�r>�˝���ugս��u��z�ۻل�j�q�g���n��&��lg_#� >�os�i>��;(���%vۛg]g-e�=� 9�b�&q i� �%�Ԥ���s������0���i�:�����ps7_p7_�s���.9w��� �q�߇i� �z��|z�i����)� ��a����:�����]���{p����\x�g�=��az��א�z�y?��� ����(��6*,jkf ��0�vq`�� psg�\�܍{�#����h���ϩ:�u�ݪ�n��� �-�w��ݲyw�~ĵ/ӿ@��o���6y{l�����]��u��z���;u�?�)�5v��w׈�� n?�~;��sz�g]���b�_�%�����k�_�9]q���/� l@� �^���e�m��kq��-�&��|e��求��ng�� ��ejr��]t���wr�6%���o�۰6��c��mh�^�r�m����i9%9���w���d&ܕ|ދ�1.�,zo�������'�� %��g���7��x�#����sd�u�ü�e���g=���6nqu^��b�-��b�~�:ٞ<�1ǟ�'?��d��'?��s�t�) no���'�kd�y��&���/��h��<������['�5����h/y�� �.c�%se�tq2��z?�7�&܌[��zo�l�r�����^߃{�g��x|0���0���d��!]l~�b��i�s�(�&�l�e�b��\��6�������x�qk��4���s��e����v�*�}�{�� f,:�� �a���96��~�k����wލ�k�n�=����e�)�[�'[�`kⰵ����*[�akb���툭{þ�ֶ�ˆ翅�ks�”6q�&�ڒam[��(�5����z�!�zcw[��<��x����x\(��e�ض�����>��{�����yo�u���]���m7d����m�n��ⶰ�����_�rmt�&�tu����ķy�s��<蜏8�|��<�7&��u�� ��$zu������7��e�"y�����ok2�'2v��\'_�����5�� 2�l�􈌹e��x�l�%�ȓղ`�蟷�w����7���e���ի�d���*��8�v�q�qw������ �s���ğޡ���vݫc��p��p�/�sw��w0w]to��7[��f�:�·�켚����s �p �p�;�����нv�����с�u�`�t��wf�k��,<�gvx ?��:تv�����v�� t����n?� w{}�u�����k��� q���.�'y�$/n zj^��t�'���� �xk[��v��ul�va\mw[��p���:\��z�í�9v��'�ga|l��� u���a�xx��u�a�x��jޥ�׫�kt�su u׈�gu�^�v��]���l�؈z��v5^��#lj�]��zuv��y�se]��.uy����u�7t�u*�zq�����u�w�]uw�� u��*�jp%e���juo�j�re[���w�֫b�t����rl� �� ��j��j�^uz�:�w�֫nku����r�� ui���^uz�*-u�֫f�t����ty�t�..ur�su�u]zu�^բk��w�.��ke���n���u�w���n���]��� e�j�rư�� e�j�t�/���e�zپ^�/���e{=����.y�%˻dy�}p�d\��� #��&��-��ȩ92�e>ϗ5;���� ��@��z��"�.��"q�5^���|p�����(�#���9��/�k��>)��sd�nz-��"ѽ�v�hu�uet�we$���,���td�nѽ�f h��>�dom���;�y�5�׋�v�wc�}gx@l��yyի�v�ke�vv��wձ���je������uw������w�u�u�q�;�ug���n�������w�e�]�f��pc_2�j;1bj��99jl/��u�z�[ �z=f�\m���]i�c�:d�!wr����ޕ��b�շ\}��׻�zw�r�!w_o��1�g�[���ba-�'w���nm�_�]5;jx��)��kg&'f��eyq��눭��];��j��$ ��e�$kyp�e��zi�j��d�*�e@qe@qe@���|�w�����x� y�\��vesq4esq4��ʝ���v�w���tvad%i��6���s� f��5��6? �����mj�v�s��y�����m��vg�؈���3% ��aα�o�pw�����]�4��=\�}ͽ��������h3���������a1���&�����&�8�p��x��l|gr���>��w{��������i�������6����c�{����=����np� ����6�����:�kl�u�ǭ��ʗ�������ti��t�_�ܹ'�64&ۋ��=�ъ���c����>���z<�q�x��z=�߱x�ƹ������o��{� ��ʯ��=���1�;��\�ڵ��**-�r;����/"���s��oj=g��g��>�l�\̚,��9 >��z�?'ʋ���ѭ���ek�yc�s\͚ &ăi�ޡ�)�n�vq_�r��y��s���wq�9k_e�9.g9����t��w��j�?w�u�;�q�w�]�ڝ��t�wx�r'�;��i�n*wr���t�p'u;��i�n�vʯ�ڬ�g����qz���(ivz�����act�w;�z�w���ap��1�����{�eї��a}xpϸ��o��{���qp��{��m㠾;h*�wlfc��>8�� fcl;��}&��� �q����hx���7��m�������4��8ާ����wp�r�-�sޮ�j��s�f�n��8 :>�l�̳j��g�|�xi�n�=#l��w���`�?�f���|�!w����[���.��6�ns�m���]��ns�m4�fӭ4����n��w���;����*ỿ������lk8��n� 7d�roϻ��)��w5�u=����3~~r��s~�:�!u��碑f��y�꾞7su�\u3w��u5cu�xu����j�roϛs�未9�jʃf-��yw�5�a�;x� -t�zg4�o7�m�{��78�������_?����g����h���;i����4��f��f����i�o�~��p# 7ұ����y w�� 4�a? �����k�^��r*o�����s��h�"yj䩑�f�yj䩑�d��t�s!o�<�����d�%k,5�8ʙ�֑����3��:�/x���xj��ak�zk�z���a��zg�:j�p���5d�!�����6>0�'�����pqx<�"�]�`�–�h��ơcv�y���o��0�����t>�?ɵ�h�)���p4���8��|�o�d��o�s�4>�?���,�����0�����"��s�e|����~^i�/6��x/�e�� x�ë������0^�:��a���a֨�������f���?��� ��*;f��ۛ�� 8/,h����o�to���;ë�á���b�gp8��18����іo��0��n�g�כ�zo�����/�>���,��x|������8ט}‹�7��e�>�}���gp8��g���"��s�e|��4|���arxr�>)r��7gs���\��pexj4?%���o��r7�l�� y���y��q��]�1��x�����)�?9j]ȏ�]���e�� �(��6l��oc�����1h���0с�����<���$��m��o��8/<)r�9o��'e��"��f�m�^��� ��d��tw�n܅9� �vt���x�w���k��ut� �a֢9l �մ�j�b5� ��j�}$v#{ub�:�\�x�n,w'��j� տ71�2�r�cs�д�2�)�l9g����a�|[ܢ�����"�[�y�1:2: ��<1>o������cb�!1��h�?]�-�g���|�8�!�g�7���1q;�����ѹ]��e]��e]��e�[�{�:��3�:��3�:�����l�8��g��0/�07�e���&� �%��y�:3���o��m�'��q���t}�3�$߈�%�э��d%���ɭ^�::]u���owէ�����93}�l�3����93}�l�3����93}�l�3����93}�l�3����93}�l�3����93}�l�3����93}�l�3����93}�l�3����93}�l�3����93}�l�3��n�l: _���o�չ�:qv'��dy�(�eu��n�չ�:qv'��dy�(�eu��n�չ�:qv'��dy�(�eu��n�չ������%��k,��xn/��^��^��^��^��^���q��5d�z���2��^�x&a���e�4���l�n6��;ʉi��~wwk|���]&�l��lt��_iz:yqx,�t[�%;� ���3�\f�k�re].�\6�t��������m�d�t��.���2�\f���r].��et��.���2�\�$]4im�e�t�$]4im�e�t�$]4im�e�t�$]l���=�?�<܇�� t� :���v��v��v]4���uѵ.��eӻhzm�i]4���uѵ.�6g���؜�3csflό͙�936g���؜�3csf��ʩa��[؅���@n���u��:��9�3϶�������r�9����_�.!o���k(�%�u� ����n!o���ɧ��sf��q�ig���g��v{b�� $��n�����q��(�vy�?��g�,�v��8���{}�z����`�� ��1??���x��� a� !c瑷���y��<�vy;���a��a��a��aj�:ڬ�6���c ���m��3m����9�d�$�m~ j7?�� ���'_���m�f^������!k�ț8�&���p��p���r{��&����r�������=q�}al_����}a���ľ �/�m �m �[�>�[��3�t����<��t������y��ޡ`��;��� 'm�i�c��q�͎��� cso�~"����'b���4��6����mb�mbi{���"����-b{���"6!�6!�6!�6!�n��ܿfj}�zojz�����i��i�ii�ii�ii�ii�i)m����������s��9{���~�^?g����������s��9{���~�^?g����ϙ������ k�ʚ������ k�ʚ������ k�ʚ������ k�ʚ������c�ӱ�dh}"�����z��y���dz1���p4�emhyzv�5>3���9��|��/ď�e��c�m�>�}̾q:�7� m_��:&�i&�i����pn_� ��i�z�����/c�˘�2&���/c�˘�2&���/c�˘�2&���/c�˘�2&���/c�˘�2&���/c�˘�2&���/c�˘�2&���/��q�����o�hf�\���m��?d�5�c�m߉nm�mj|>�lbr�����ד�i��о\&%7�.������x}8y �d��ԛ�[a8:8���- [��vg�ԟ�h{�����'��k�����*�j�u>�*\���oëɟayh'�#li��� ƒ��� ���u��_q��\=��]� ��:��=��'׸���jr��zt�u�huo���jg~[��:�ag���}���_�g���u>1=:���%��c����ޓ���í�����3:$�"lm�nl�nj�g~>*<����,���r�v��trmc/�ե3������7����={ҵ���~�j���pm��(d�ќ���뿝�v�a/d��߃c6: ��m� ���܈�p3n���~- �e�ṧ��'�f�-�1hc,���m{c�%mji�zҥ�4�%mji��ѥv4�mjg��ѥv4�mjg�a�n ]m�᫐�mr�i��ո��:l� ���܈�� m�q��]����;���x�)q>�ӹws�&n�̲�u���ٰ{�����g��w����%�ڝo��ݕٽ0���\�7��$�&w{?�.�f�~!�ƥzv�s�ww���^�j�υ��^�j csm���qs‚�t\�kq.��?�4\��a�m�msf۔�6e�m�msf۔�6e�m�msf۔�6e�m�msf۔�6e�m�msf��b�k�j-a;����a9~���xk�m�.�e7z�9��/� l@>�4����9 ��<*,j���>���hk.���[cw�\��u6?��4[o��4[o���{���� �x�k�s��f����q�%�uy����v����&�@k���2��qqufčqep� ��#(���� �8cttd@�a\�&�hd ��@�h��mbx$ �{}������u��unu�����@y�%�u��j����@��|�.�n�p!h�z!c�p"� ��z,sa5a�@�a-��\ zj �]aς�f��mt��l��!ns�¹s܅8�ǜ@7#|�z�t��n�� ȣ3�^�e����0��*8b|�1�˜�ø�#a����= �a�g0�#����{�=�hh8h�ff�^�z444��u�8�x��7a����d�۠i��jh�z�m �t#��t � �51�����,h�9��aσ�� z�"h(�%�0�p��(�ˠw@��f�ƀƃ^s� ԑxxm�e@q5�,���@�<�s�j�c�ro��3�>���~�����b�a�!`u3��~�a?���}��>�g���ه���~�a?���}��>�g���ه���~�a?���}��>�g���ه���~�a?���}��>�g���ه���~�a?���}��>�g��������b� ��6kl�ج�y `��;�؝ٰ;�awf��*3��d[x�����m�˦��;�`6z��1�m� � .6\&l��p�����) �sl&6��ɇ���f�a3���2ae�nʉm� "6�a{�a�(��ly���=�j]> zvt�,��yё�����}�>�_���ׇ��c������}�>�_���ׇ��c������}��w ����q���l�>t��>�m�fa8yec�|:�;�)��sf�}u���_�x�j�w ttt4���m����1�l���e�\j$�qm���tm,��"�z��[�~9]�>a|o�h��� ='����bk����gȇ�_�ngm�� ��a�����@}��b��(��"� 诠[a���txoxo�r��j�����z�' ��2��!x�ǥa��cl3̖��-w}�8j΅&�ow�5e�6<��c� �����wi���&��ܝj��@�̇ ���s-��:�� ]p�*�yκ �<�g˩)y(=�a� ( ra(�o�*���j�ua �r�p�z���ʠt�;��ipop/po�3�>���~���[>6{:l�t�����a����n��{�^gb������6��e���q����� �2qw}- ��djbk�[f����:��h��|���,��o��=�ߎ����l���nm�#�t�u 5fk��r�p�oл��j;j���䡆_pc���� ���ᘁz��uб �4�b�![� r�"e*r�"���t�r��сhs�{����� �z�����"����q(i��/� _�6rl�"��e�}�p����;qjz. �tiz�4�:�f�@�3u/a�/e�2է������*��v�ѡ�����(f�9(�%�(�v�bf��!�/�4|d��l���qcp,����9������ӆ�k�f�&�~jb@š��c�%w0���g��������,��(��z ��'gc��`�b�a52}�\}dj�^�ƙk��s2�i�p�ur�$�d˶�v���d�m��� ���;��"�ge�9�i�{mz� f���ր-is��\�lr'�u�#9ґ: >��ev�w����jre�da�b�a���@�j����<��n _-0���,�"�)�=�oljn���1��@���v��>y�m��͠|�m�� �t=�f����d��,�n6�sq���p-�h�]1/���p�� ���<� �1��'@�a=pn,�_�3%g�n�����[�ڊ;��s�\�����n>����_:jڢ���n�;�%9s�����֦���� �?����>����o�g*� �;u=��g@}@}a�pr�_��f�?�q�f�a oc �� �� ry�x��rqo��sy�-*2y1d�b��zc�eͭ ���<�hׅ~ʊ�m����>o?�u����@���i�����̄� ���l$�7���{j�*5h� �}�l7����e��w�>��^�%��r�v��e�k�ψ-bl��l�j�r�z����� j:�r���oet�})s����;w� f j 4y�����{ҡ�'l��ua��pl��( )��bx�>8 ���b�zp@�e�y�z�a�����v�r���(ij�%�s]`��k)d)�(�d�l��.d�b�.1��yqu��r�^��>����%w�f˜.q�p�~�cٔ��rpz��,o�?�-omb����kz�,�a�� �d �i�?��n�ȥ�����*� a�j��r��1�}"�'�>e����_���a�g��v��!�g��!�崷�r�v���l�u �֠�ut yj#���zuq�@�q� �5�z�ue���z86�m`%� 6���45�uߔ�����g��i��r�6�k�z m���bj_!\-��#&t���_r��4��rauq^�� ��4f\����j���cv*j�i"(e����cvc\k�k��!j��f�ʭ�t��z��?���h���כ ^׍�@��p���i��{��з�qoĥ!m]��c��� ����4m��)�n�s�i���s1�h1�`ڶ���t ��cl��i�p�k�q������s�ubee��{��� ����ut6��!fi9򁫜��-ai�si9an����������ύ��'&�~��̘;�**7�s�٢�e���@ ��b(�t�%�,��a����p�2`cs��tka�k��jyђ@�?x^i1p c���hm����%��"լ�%��u#���v�v��e�zhs��"]#�k�tm��)�& k-6�ub�����'c�m�v��������2���ӥ�]����8vd.��cw�/�ߠ ݩƛ�;�$��4�����ҳk�8�`7'�k� :6�u�[jm�r ����ػ��]f�p����{�ͤ98���h��v�(z��-�c �ov�բu,�5���v#bof�q>k���^v/�b��n��ua��^֝���u���x��7�����c��<��5����w�%��]�/ᗰk��� v)�#���������ϼ5����od��6�vv-��������v�5����n��xgv#�?�n����-� ����=� ֎�/�g�p>�=����xo>������/�`�_���5<�e�-�6���;�,���e��~^�p%�-\�hhᱯe�hb�d�hf euq���e��h$�l�t��֋��y���� �(z�t�i���b��ϋ�boyb5�#r�/��(���bv�_j%[���v �okex�x;�k��̚��y�yk���rk��b)># e���r��pb(�����w�օ~�١�p.� mm湡-�|�1�kh'���� b���|[hh?�*s?t��]��c��n�����j²k�i±�ۿ ���ߋ����dc�f�v�ҿ�~n\j?o�c�g�_����p�=�%�_�_��c���q{�=ano���������u�u��8��!��΋�pk�3�n qf9�����8�e�]��h'�ɴ^v�:s�w�]�n�u��)��8��}��0��z-l�-k\x��5>��z#�n�� w w�&�sé֤p�pmkr8-�fm��ik���`}��d}y(���ȣ�g��#�e�>�<y��4�#�ú��m}��o͈ ��ő͎,�r# #묂�o�m֞��hm�`�atd(-:*:144�itnh|titw�w�5b�� �kc?�w����g�'m�vu3l�������no����h'���av�;�a7vg���m����<�m�m��;�}�������}�;ݝe_��vg�q�s�����"�����ܾ�����n�r���ܵ�z�����iwrw��� ��{���xd�����g=˳�^����d��=ī�հgx5���h/�kd��5����^{�7�h�� �^���fz/���^�fۙ�k�k���q�8{���7�����k㱘=#�k��j��������k���ìbљ��ss�kges?�����e'�^�������8�wuv�i嘫9*� aڢ�r�y���ȵ��r�=jn��s�| j��k(w���;�a��쟨 γkk�r�9a}��:����/g턶~�[ ʜ`j�uj���u�q5�v p�h���z�<�yp��t�b�]�r[Ԧҩ���n�}��kp�"��y�jmc�e*�t��qc�2�=��r� -�u����t��]���j�����뿔��c���b��՗�{= ��plʅ�l�=h�a��ځ�),�2����v�}j%�]o��r�|��ڪ�b���w\�h��zf�qqd5�qe�w[��g�=z&��镀��#5��vph�����:95���a'ͩ�q:��c����ixn�ywxh�ywxh/��� �zj[��ҷ�}&:���{�mtk�������|7�����u|�t��l����z�g봎ϲ���~�:>ۤu|v�u|�m��l����^���}zg����jb�x��x�x �c�bxr��� 3r�!7��ɏ�סߌ�ɉy?is�=r(re��!u�s�fc�"f�"��ň����(j]����� m�(fٔ�1� ɫgy�c��¯>���ԁ��א��!jd%��*f.k�f.]#�.� %�� ����$hg6u�?af�bfs(��brki�i$5�hj5#��fr�r�uym��r�q5h�d�n5d�l$�&$�nj,�7�w@�>hs#͵!��ĭ��mĭ�v��k;e���cze�`��r�ur���}=#�����6r_��}m��)y^#����v^k��#!��p=bz�ֈ�a�@r�(o$gބ�#��m�q6�$�qry�o-1��vto�-��^��f�^��*f�t1�a�<�\]�h�슘n�q�!����j~c,�1� r��}�w�e�~u�u �n� �cp� � ��3b�@��r$ҽ,g#f�n�ʱ��ȥ���g����| ��$�3ynf�l�����t��@~�v�p~���&g�ϙr&�d����/��b�e.��i�rb�j���(�s]���e�l�[pw��j��/�-�mn��r�܁w�]�y�܃���w�d��ʽ�d�܏��(�x��� u���!�^"k�wieq�#t[����#�g��`�8�=p{�1�� �;��k4!k� 1�&�m�`�7ҟ5����"7�:�����]�����|ɥ��fw#%���m乛��t��s�pu���r�|7�j�[�mow�#�w��tw"�nw7�{�bju��"����c��\-vr�-q�x�tu#��ga�lj~e����h�z��uel�w�r5�qu zm�ky��&ͫk�^=�j��5@����y��!x��7�7q�[���mdɓ��(��]��� r�f@jj�;@���r��8`�0���t� �4� �<�� ��%�o�v w�j���' � �}���� �n�/�`_ �}���,�%��ڲ��wa@:��}������ oc� �d섽fƈaf� �gа*/��#4v1���c3ؗ ,aq���pdd(q�m��h'�q�z� ꥉ��=���"^#`m��i�~ёj�"` `��@��6x�j�^���z^m������^c�0x2x�"o�7#fc����[��mގ�ū k�u�ؾ_ޏ}g�);���?(�^#�4�-cf �;-d�l�^��a��h�m��#dz���ֈ& � �ha9te���0�ht�ݢ����h���r � �pm�6an@x��h�|[����a��2h' �i �l�5�i������{�n�a�k�ת\ \�np-��z �k�עr�܍\ݪtk1���a��0(u��h��(�3ҋ��3�g���k�h�o$2 21#�1hģ���7�r��4ip}xj$�`gu`�^����)�(�h֨�� op x!�3xq��eu e�)��/i4ft��xu_����4ft1�`0"�`d`�(�-�-��mb��@�*8��w���.{�m�����7�k�h2a�蕛�4ej�i�(� [���zl�~:���:x�w���e��?z�|{0��<8>pq��֦ک���r�,m��:z���묥ke�`��lݚjui�#��\�6���(a�6qǭ}��[$�l� t������wۏ_��|������sojip� $yg�k�so�8a�u'kg�� ��&�1�x��b2����w���k�7 �k!c�*5� ��s��s�2w�������e�hn�d>, ��q�>:�ӎ3�гg�߃��ҫf{�j�����۶�5��ӓ�3e���}����s/t���c�s�w6wk����6�� ���^� �o�y�a�s����q�ǯ4!|�z��$�o�� ��(u�w��ot��2�a�w��l �t ��h���� ���:���]{��f���v?j�f����r�n ��.�4����eg-��ʸz{���]�*����o*� _����� ��b#f֓�s9�i��}a����֠��w�m=�<>v�n6oi�-kk?aί��`p�?u���g���s����g��y���$ό�������>w���j˜����}�y&v���lɷw �yσ��0�7�'��c�rx���r����|}�`z^�6�s���2#'x�rd�um�]�q�;���{�����>*š�s�\ne��ȹ�`�\ܜ�������\��1g��h�g@ϩ�p���~qtm��3�_ ��j��n����!4�x������-�j��5)>fԃ&s���ay 0ڡ�s3�[y������g�|t�#5�o��sqφ��9b��ѻy�c�{����:�~&���y��9�����v�sm�d]m;�&fz��zit�=!?��uxr��`l%�,��s�8����tϫa�� ����^ ����q�x�ͭr�\������lt�էe�!3z5,�%jw�����k6'͛�uok@�b?f�~��h�彳u�6�v�}�0go�,c9�p�j��.�� �p��sc͡�q���y`��w��5u�[��*����5�c_=��q}���ζ�r� �u>��ۣ[!�;�\3� ��[���o���m�3�� ����9ѧ:��5bj{�a8�p}g�9��nqci�_?wn��u?@:��� �f}����v��_u ,�( 0g�8�u�ʮ�������o�ut���o{�k}j��㤜|w�ϥ����vn����^����>36ù�gӳ�̯��� �i*�ƭ%��~�w���h����� �-�j�xp�ֽ�^ �o��q׼���öz�lz �����y�w���~������uϩg,u�%����f��?��p[�o�kkp*�����m[���|cl89���s�ns��3*gc@_w��[��2�t��%h�%�k�!c���8\ߥ����)s6�him��l�����f��ר �s�oj6!��=3����8��)��4��'����~({纄㟾��uj����ԩ�˕�w���<:�>e�$_���h��*3���s��0�ڀ�o5���v �n�$w|�4���֨-�k��6���(f�ui��������f_j�ު���ƙ��g�l;��9��� ��ն_g5߼v�:� x�k�_�~c���� ���k��q�pg�փ���qθ�<�y�t n��ԛ�� ��ǩij�zuݫ�0�j�l/?lq��t5�o�t7��� b��wp/�ԇ�_���ְ��0\�\ >'����y �d�� ��\��zq;���2�u��s���'2f��� '����j=�˧2 0�����*�$�΄a�oh ��cd���?� x������ȹ8��~g�gkk뫮 ��'�_�~�)�o��> ��8�ޛg�wm�s���@]j��n��n��v�{�� �mp���ݛxm�� �p4ߖc�3o����a������2�1��kҡi�%�_|��#�s&m��]�ut�ks�(c�����^*�*t�{����pa>{a^���zb=�^22�ƽ���1��%d�<��p�z��5n=������c�x����n�ͥ����:g*]�����)�� �=ga�u�nƨpo�sh��)�k���a�0�b� �ʺ�h,���t�s�fj�b4k��ϵo!���%4�����,ޒ_dk�o!z���w��ڧ���i5�ʻ�zޓ��u|�~��d�����?���>�ϡm�s>���/�����|1����,�×�et�w�����h�p�gd�h���/)���_��h$1i�9�pt\$.b��3���/�$���h ڱd�^�˪�o/x ����ծz؅�tkk�}�����y��a�cu؃��p*{x{�aoh/=����þ�^zx�����^zx��� ���?�g�����fk�<�m홇��=�i�3{o{�a��g6g{�ak�g�j{�a�g��gεg.�gҟy�mo�'qw����'��}���'��}����'ob���� �7�r{�ῷ��_����l{����xxk퍇w��xx����t��y/�v$��d�(��$8�����$��n '�?��q����n�w�?���s�?��>�i��/j/:|����_�^t�p�*�*>r��ᣴ/�����gk_:|�����98��ڗ��p2�d�q���=��iڣ�� q��w���p�og�3��k{��ڣ_{��i�:��k�oӿt�t�k��}��ڗ��}��ϵ/>[���s�/>/���h/:� �e�/�^t�r��/�^q�^�g���#�g$fo�v��kq���#�w�� n��p��n;�!���#j8�e�g ��p�h�g���p�x�gl��p�d�g���ሏ��n��x����?1_�� �?���#i8b���#vk8b���#~t7�9b��f#r�7�q{��ڛ�ء�و]ڛ���1g��xl�%œ��l,��k�(�y6q6%p"1̭uh`vmal ��m��?im�r��ha�s�e� s��@7נ�k���݁\�/w�no��s�w]qo7�zq���� �d�m���v���<���t�|� |l��f�������<�%���"���zdddf)zd�s�:��9 b�! ! !��n�/,s�9j���9瘵�1眏sk9���pg��z���9�q�㜳���� 2�篧���\~���;7�{���ʇ-t�w� �@��\�͙t7�p7_��e�,#g������.���jh>j��ve�-vdq�ى�: u��@ѭ�&[��e�ͣ �g6�*�bt�`<�:�u�]�jqzq���xo�> v�e�}�*����i�_��o�_%��$��s���r�ͥ�[h�w6���\�r�� �|�e(�"?c��ȟbe>�_��s�.?ku9u�cϡ: ��<���fϡ=�jt&j�ij�q���j��b�f x��y%q%хqkq������q���:eg����j�;���o�v��ֽlo�5��jt�*����,q����}z����mq���ge��t�a3t{to�������tt���eܯ�-�{ �{k�{4yhf˄)���w�;�'�z�5��pq�����j�$�� �!� ��2w��l-|,|�4¨0ʦ�m�;��n����߱d��g ��_���l�pw��f�����'�"<��? �]=�n�"��g�#�?>a%�_��b�1qɦ�q�����(0�!5c5l�/&�dq�8�ʼn�(�1qld/�ib�`�b��wmù��87u���i�l�,��s��\q.�}f|�)fb�g�g1?k�����l̟/�g3�1���s�\&� �<��h\�s��|��x\�9b�]".a |_ĵ^_@�x,�̥�r��l,c��b� f���l-�"��{~u���:�kx���w�kp�zq�u�ŭl�h-l�h���ct���ucl�l��&��n=���'�x�/��b@ `����!1��a1���7�y|of �7���=b��;4��� ��x�����}�[�x��k܅�[� ����-��z��] �p�!�o�xp<�s�y��#�gx���c=,ƹ?���(f�\<���o��/œ��������o�yf<������sv����n>?�]]���(^di��l�xi���� �u���>?��ߊ��:7�[��{����g�o��@|�'�g�ϸ���c6���o$b���������y��ꙭ@��ngk�s�,��< vg��u����:w���b�"��:_���cf��s����h���u ��t�3���!���%\�� ��s [ĩ j��z��(� j��z���ʩ������4n-�zx1�6�s �z0��(� ja�z�p���5��e���%j��&���\ � ̔52��k�4�a3�� �]�u�xӭ��y`���e� >]�>ͷ0������~�~��s2�4���k�s�:l!g6 ���,^�`39� ��?�ă�1>9>��{�������y~����e�'�ǧŧ�����1n�o�:�"�t�e���>a=���%�7$l��� _�xc�&6�32���l����09a� s�2i������x)�'v�kx�ol�� ~�~e� k�6k�٧��j_e��-�6w���x������z�fqr�t��^�c~�t�9ɀ9[����f��d�̘c���c�l8�,��0y �.ʌ<� �<�v��fk>if�_ `f�ԁ�a)� f�א钶ce���#�@�!���^� �s�ԇuޔvb�-�[��kڅ�oc�~�gߒ�b���n�͙�=���r��i�c˥}�0�0��q����#�@:$��kc8�s��/�l:��ϥ�#r�����n�,�_�s��t�='�'�����0�rv�2�� �������k�sy�w�"]�:iw1�x��-_�v�&]c�8e�9����ؑd�$��@�q� �3�*� ���m�z�אy=���$~#�l9'qd@�l'q6��(sr��d�(��i�-���l$�$�g�5'=e���_�hl�b�w�b��sn'��al�bl����@�"��z �;�p��\r=h ��\r=��@"��\$r=��`����a2��&׃5�z�9r=� ׃�`�i �de"��,�-�x!1n�u�$��w_r� �b_t�z�i��t�y����4x6ʖ�b;1~m��s��4x� �(v �a�� [�8���r~�"�k�� �ו��|�"~u�n&ru�\��~�ms~�:�|b�5i�ːd� sɗ!����d�/(;���2�:����.p��|��w�>k,��������\9�>�q� �k��3��0[��g`ُ�c��c��d � �/2�u�ʽp�d��w0�y�?*�a̽!�)?q>ƙ;d�u�)���odf�"n�1w�ȋ���gdyfd�m����dp�b"��d�k�� �fǥ#ϲyaܳ�漸y���͋�r�r0΍c'�^� ��/`\w�r�^i/$�ώ[�^��9��j� ��x�������~�%m�� wr�����7�v�c0�*��ic� ͚f���8x��eӂl�ƈ��}b1���˪�:��v�v(�vr�p�������b��j�ҽ��w5���y�����/j~��y�gx�y[�6漣���a���>v��c���'�%�^�������xm��r�p���q"����)�s0�w ��(�.be|j| z���9 �du��3�3�rt��d�&�g�ȧ%lb�0-as�fdjjٲc�jj0a� f�5� �'ء�a'�v��ag*9�l%��$r�i�de=��'͞��^��f�زi�in�v� �wq�40� ���/�q/� a��x�:��,[�&�sr"�{�g�6� �v���}�s�',�>a>��mȼ�na>u �k_�����ox }s���7�'<�>�m�����ox�:�g�cx(}g����w��cxbb��t�� ��t�-�!�:����c�12c�ox�tx:��?�~�<��c�jǥ�8z �"� �pop)����ѳ�9�y�p } }���7x"�f�����7(@o�v��au��qi��}�b�����z�y�c>j��-�62��(c�#�ř� e� r� � r� �%�9�_��b�#r��7 $f�h�d��#�%o�9�4;q����;%e�sr9�e'&%nf��&e%nk�� �n�g�iss�p�;(吃r9(�#��d|�(�q�"� �q�l4&�����9td~������hb�=��� y�p�s����&��e�$�l܉1�c�"?���ǔc~l�ȏ) ������x�ⶱ��nbhz� ac�&^m�����݈^�.��~�a��(��4�,bq�)f ��j� �n��#n!�" 3v�dhi�kwog�!2�z��կscku ���uo��a�el?��nf� �w�}�u�)m�0o�bх��}�����;�a�a�1����4�u�{�ad��� 6��c�}�~�^�bqx�z0>�8��s�!x������1��x?g�'� �����x�c�f�h@$ǟ{m "}�5���c��j�c��8��(d� �刊����_�:�ƨ^� to�։we�f�k���v�_'����~:���������"���f��u�~o;;cߛ�݈}o�@rm�*1���ګ��\�jr ��5 z�:zך}`̀>�����y��j�5w~tuf�����|r��z@z<1n���d~�ϫ*�}����u�pl<���[|]�i�5�k�i�a��g� ͵�@ �_?�/vm4�|=u[�f__u�� -�ڡ��n_���*����^c��k�a��*����[���e�c��l��x�b ���:�[c�f�?�z��ϭ��=�����o��i����v�����c�����?�z/���v��}ǫ������ :h��;����q�n���>��\g'�ǭ7�'�����{�sևz�:�/��ܤ�/��a��;w=ڔ�;g�]��hj����3��u;��|����s]�d����u��|���r|�|쯬kj�x����f��)�4{b�дmn*��4�@ӛʠ�m�4��f���w0�ݮ:d>�w�״ο���i�s��)�ê��3�����-���qy��7vu�|^vք7y'���)��θ/� �a���������x�=�&a�ۦbϵ�� ��`��b������� rr�e�59�x�- :ږc��7���~4r����o�x���7��5�9�x�m��?l[ k��ӷ���c�6�����p�m�}9������5�m mi�c��lr6�g�vݷ09okf� ��抜�zd�­ym^� �6ha[7���zֶ z޶zѷ_.�geno]�v0|m˴�咭ۆ��h��2���z�2u.ߺ��(t�vb.��h,?�s-�r�6�2w^���vzb�mg�u<�4�s-y�ƭζ�kco�uh��:4�v ���.tg��ζǒ�[w{����,k��e�>�f�b���3�)���c�{j�=��w�˲m>ps�����]z��[>ts�&�j�s�cz�-�k��л�,�[�[��ޚ��|dي�am�� �e�epѷr>��f�%��,���j��v�ǵݖ=��t[%t�m=�a��%���z�˧��,��y�m�c��� ��ͷ���bc�ː|���f"�m�2� ��慮����m���n�&[�o�ֶ˿�����m{������l�i⮐�}���/��lc��<�?x���zm'�b�ed�r�������v�v㣖k�fh�>α]�n�]�v�na{mw��l�=�a{���s�~ox��.ko[���j�4 't?��f�|m{�rk����埁�$��o�v�9 ��k��ڣ�z�y�ts��d�ys��t�hs������k�ž�ګͥ��ͫ�w���/��j^���ۼ�7l;������լ�w�������n�\��i� �1�y��kj6�g�n��7�}=��f74�y��=��_�cݼ�|f��� ��p�r�{�3i��;�4�c�������yl�ꑱ���g��toxn7��ta�<=����*m2�x�䍦|o���י�ts�g/�9�(*i4ʹ�3���sx�o�߫ m� t��ݚ�á$���c�q݆�>y��y���4� lǜ �ch�hә�g�su������v c'7������}�u]�c�y��*���'�u���@�n�=%p�����u���@��=;�jw̞x� �i{a`�n�^����_�;g/ l�]���"p��u��렣����-��]0��ٍ���p���΀\��{�{ �c�� �(���n1j�k�olp�}���.ž;5>���a��@_]�}_��.�~ ��.�~(`�ˣ���#��u%�ぁ�2�)���g|�� �y�:�e_w�f���5��:��&�h������c��g�su�"�'ꐠ�s��k��������u;y`<����ݎ��϶�n�#�p���9�n�q� ��ywʱ:p�2p��\.םw������7�.:6�vێ���|��_w�`�c��xt��i�x���4����.�?p�;�����,������,�쒣�jg�ӝ}��z����n[�����/�|�~�s�4�ah��ؓ��~��dp��uc\�<�ꋝ�s�� �֗:/�wz[�*�(�y�!�_��[��y/��'�0�s��9̯�iq�� - �e��w�:�kyk�|��ܒ��5<�~�v��m��'tc����9a���c�k����˻�״d�nܜf�e˶��>ܒ��v� �˫n�����0�"��t�ã���<�������ʧ��[j@������-e1�(��h�k�z���8zhy7��?�6d�\ )�7i�@�[�4���g�$ca�y;�t�m.��k\bh���%�� 宩� �~^?��*���<�:[~(װzps߅ΰŕ*6�\9�r�ѕze���bk n�2���z^'c�{ r�ǵ���� �6��ա�vwe�`��z2v�6���.-t�kr��l!�4l8ಅ��.�!�70 y- ������ �]ݡ~�)woh��kwh�p޵'4ȫh��k���l5\s �nn���.�n��q� �ά��v(�� �kγ���k���h���θ.�n���n70��н���[���u7��ar=i����r[�� s[5aucvkr8�!�uz8�!�5-���j e��t�pfò��pv��ւp^����paceki��a}�pyæ�5��m��pe��ucx]��usxc���&�j�\�氱��j[��n��a[�v6t��þ��֮p`\w�����ok��־���=��� �[��w6l�nj �k8�z8|��d��!�s�ni8�z.|�a��b�tå���� w[g�g��zo�g��ކ�j�>�p���o:}�v�/6���d�u"6c��q�~�8c�s�s�?gc� ��f �c�q��x�� �<�m�3i��[����#�13���@����m㿽�߫ts���tdvź~��fdu����t�u��1ş�����r�m�`�rp�,^9i)�i�d�����la��i��l�2s�,���v�g3��v~�͌[�y�*� ��4�&4�t��/��$|�o%e$}�e$�m��*���b� i�'�����n�%�iz�.�n��t���il2�gs�z6�m`5�u�c����kl; �n� �_��`g�*؇ i��������p(�� ��3���te�"��qd;�}�o �����w��ľ��©����� (zuq�k ��u�� y���m�_��껊��jpѩ:����k� �/ݪwu�)^���ۡq}�xcuu5�xsuc�;�.�tp�v�i�g�w��ͦ� l�)�/| �)����?�} ptו�}�'!�my�1`y�gȳ, , ��d�x�e���ș�a��������j�&�hb��0xð�e�% &�1� !bkxb1��`�bb0&�({��^k��1���ڪ�n}睾�����9�����u(u;w<.]s<�(�>q<먒>�o*ht�許��s-g����t��h��;|��e�#�gy��7���g��-_q|߱�2��`�:�8~n�wq��8�:nx"�s�s����\�o-����,�r��q�����,��[����x����g2fx�gfq��֌2–���-�2�6�o����j��?��b}�������3vz�3ve��z���x�2�-ㄵ"�d�y�،3>�n�,��fm��݀a���9?��7��b�lq��~� �� e�h]�rpݨnq���yݥ�u���c� -�՜z�6ijc�i�z�6v���9���\���s�zn��^q���4�ԃ���w��ǯ��?��g��b�#�t�1�*,?��@h�����j���z޵� �x#�a���"�e`y��-��.h6���������x>�|���_v�*���c��!�o����`� � 1ol>j-�����8�81�bfo}a �w< ���hj����c.�|a�u�z���j�:^��֪^u�j�tub\��.pѹ�� u��vݠnv��;�=�~��zt=��r���^v�ѹk�mmh� �h���nw�]�m�w���f��^ri �tmv�����<����a� ���2m�����i�-�v�.�w��*�$��αtq�b6 ���-ݢ-��k�f���?�1dd�d6q$vqj�!fe�*�bq��&�oԉ����˔u�o�*�㛃3�^3�cb&��"*�")� �&b�� �x��1��d���%��ab �p���/d��]���'b?��q1�����(�nt*�7�s�7de�������xz�=#y� q!eq��{��q����w�t �k#��e|c����[l����$͐f��j����e��]��'n��rx�$m�d����-}sz ��;;�4ʞ#^�� -_��i�� |?q&eҝ��.i��#�~,���{�'�l�����k�e��,p,™%�%b��sz�ә�o̵fvev�hfuf����2q�ז9 �5ў9's�蠹=/��� ��n�\� b��pbb��j�8�2h)p �e�r��s&(��ҡlwf)>%l!$�y�be��ly��v�)�-�ve��w9�v�)'���9�re���r-d��s�s��c�"�t-wǫ���f����f��ڤ�veuu�jr��v�k��j�u��i�j�cݭ�s�g�n�$�y��z��/�}�=@�� �l�x ���o%z^�/^��<^�0�| �|�|��qxy>��^�%x�px�px�xy!�|$��^�8�� q����$|��^__ _�� |} ��et¿��yzl* �g��� <��sx�<���y��e��or �.�n1��v�*�y2�y��=�{�ӵ���tx� ���{�#�q���̯�������2���q����4o�4�� )�m��b�2�j�j*�i�u���-��t���`xit�z����xyxytu� �n};�,�&�q�$��w0��[� ����ݥn���u]��xuxw�:�o:�������u_�p�`�p$zb "�i��zu^����s��ǧ��d/�˾ �3a�|� p)z=|5zk]m�����e]���e�c�|d(��s���`=% ���ć��o�206tɏ��n�2�?�[�5�� �6z���cj]ma�f�0z�h^3͵1}�l_#s�d �4zi-��g�>36���un���m/��l;��m�!�ێ�s�n�g)� �n�����ҷ�8�h���j��q��m���~mhx�͉l}[‰�hł�9��;y���=�����'�p����xgl�����b��༩�_ӏ&�r{�>ǜ~ך���1=jw����5?��:<9���z���z���v$íu���u|2�:)9��6�9�̹�'[�%��z�:3���9��5�\���5���:7��}�nj���]�g��eɽ�k�x�eh�n�2!�������\w�������vv�66���5)� �xm:8888�и;p9p-p3(������`� ��� ��!x,  j<�jnpt��qgp\pbpr�ln� ���`$�� . lki,. � ��4(�.�1�����}�"��s|e�?���k�)�a�rl�=�砹x���>���,��&�����i�cx�%< �����4t���i�h< }oc��4� < -���'�4��b�(g�����r< }oc��ih����p< >"��3���l� x&�<����3��l�e�@*5x&:�d'��w�lt2����g�s�l�e<���)�.\ҷ�o ��z�l��d������o�w�w�w�t<�:����3�o�۾ f��f�v������v����)~� ������r�(���!�p�h.%*����r���|d�o�f˲��q�/�����nⳉ�0��x�$�y���\\�=�bs�8y���ƿ���}�_� o�h>����wl'b��������s�b�i� 9� o�?��l b�?$z0���~�[~>�����a<�b��� �1����s���?�k��)��ٟ�����#��i�'m:ӟ��Ԫ�i������,*�g� ����v����i�����69 e�9�?��,���w� �3h�.����e9���i-��[&o���\�"�h�.����s�y�ne/]���|���|�?d�k�7p�ԏ�nʵ �� �<�d�q�a�)�$ϼ�rs�p�_�j��l�с��8߭���䀫�n��߱4��x`�a�\��ؿ>��"� ��l`�g`�|<���xx�����r\������z=sw��y<��������������^s��;l��n���ӂs�����jߚ�����%�t�c�c�e�r���`ypl�:x�t�m�b�z�;8q���j0lk����`'��e���qb= .�'�˃]�5���z�}��fs,�n"�)�5���������`w�$b9ip�l�<�6x)x5x#��q�2u��b9���q�r(߿#4��1tl( u��b�c�b��}!��`h[�� � 5�*w��!=͕���hhqh��,�v�v�(� � mmm#�d3p���o>� ":*׆����2c��7�=��*t�p6t!ty. ]�3��mz���p�\\.�k�����j���l䂏w��!<=��^7�|�kї�˩�]�}��iߪ�@���� ����վ���n�i�s6#�w�{���;���l��'ˬyi����{���%f�b���-d]4�ù%� �[ ��[��t�(cmt�(c|�w�*c�"�i��ji0���u�x�:�@��')s�ҩ4�ӕيlgt%��$��j'g��dy�t��v)k���&e��c�rv �����[9��y�ru�����`�����7)'c��ձ���?z�3x'��rb������wsf���3jo����{���;p�|?g��]�ѹ�^v��kk7���n [s��z�_]4�[帖k���w��͝�z��� �o�o���z�zf��s�wu���i��� �nꩿ�a��a�b�[ � �9!��e�� �y��m3�|���|]�����83��q�����6�,�5�k���!�8�bf�?�h�8]��t9��9������^ɗ=� �2v��8����]l&�b���>ܹdc��ğ��ysp�� �vrns��>�c_��|��h�(������� jw��l#d}r �n1���{d>a�]pl���� ���xa���x��ʊ�"� ɓ�w���_�����i&�~s?������k������u�q-a��`�o�����#v�|>��t�o��2q��q�a��c��- ����]�bx %$_6q�p�vԋ����h,j�ԟ��;��kk� s��q4��s@�vjl�q�� w��`�n:n�7lm�� x�ccr:�ͣlpi��w�tl���/��$a~?�~߉���%$g(�4ǩ]wo��"a�w,$,� �ݎ�k�r�m�6�/syl}_~�������'�󚚗�mm����7���f*�s�ŷl��6��k��݄}���#�u�z_��4ʹo�fl=��z�;��*�����u��诋�*�u4/.��:.����i\�f�t�v]���輋���r��i���ɠ��:����6��ƙm�� >�\�z`��y�7g��9ol��f�}͓kez}�1w��ec�<sm6uliȹ ����wa��o}m[c{1) ����z�y'��n_ �������u��k��ys&�s]6}���e��u��\'�#��l#n�r�x�~�q����[wh�e*̼ȹ����s }1rwi�/�ߛ��v����/flՙ����n�������x���u|�v忺yf����ud�.l�����/��u'����^lo��]� �)��m�'�s�´��g�u��j��e̱�g��k��7a�s���x��/s ]/]� �wx9ם5��2�7�=�w%�r���uf��h��n1�1��n�e�k�a/�4�a3r��3���홎���-}6��:m��o��{�0�<�ŵqη��ĭ�����������y�6 ��{� ������z�u�8�������?�7��ݾ�*���n[���u��i*���g�����=�wu�u�l�?�ј��������5a>pw�v�;f�_u4�u4ou4�uw�o�����m!d�śۙ&�b�c�=�pdk�b�]n�|�n�?곻�h�{����nc�i���n�ϲ��>�i�斍���íkjj�m�57��ܴsw��^n�����8��ƾ��ɴc��=�{���y�ݴ�p�3q�s;7��&�^�}�����>�!ܴ�p�0���_on����%�'<9���'߸����5�c�o�1������ݞzæ�k̳g�w����z���öi���5�w�[`���nͫ��<� ���?�zc�=���藇sśg��zs.�0�!c��p�y��锑�<ܞˆ��x��f�3����� �q�1��w�o��6�_ҳ2[�m?�e�rh�%d�pb��pnk�n;֘�)7���d�m� *!jh�: k� ]�5��&6�vv����k�$�!�o;^j�|�p��#d����v�! $��|�n(&�*ui��i�z��0�ԟih& :!n�kx@xdxjxaxexk�@�l�f�i�c�o8d8j8n� ��y��vl�_6�ǔf=9��5�m��o1�a�x��w��0�p�v,$��g*���������<`��1�_�6{���eh0��;� �n�e��!�v��-�b�2�j�j�:�f�#���������9�9�9�9�9�{�y.z�x�{ny-�l"�7�;�;�[�-��{�z��5�)^7��m���^٫z�@�;���]�9�]�{��k��mޭ����}ރ�#�n�i�w�{�{�{�{��so�ϫϩx�_?����/�����_?����[?�~f}s}�^'ĺn������֯�_u��~c���m���=���c�g��������/;��l�� �|�a�� ���hȥ�s5 j( j($*!�p�0��z�f��� ���� ��ņl��b~q!����/.�x�r� y�ņ��ņg�[ ��c�o�g��8k�s�9ny<� ;[�dg��.^v�s�.<΅��z��_s���#�;:? �� �?n�$�j:�w�%�b�q�#κ�`�r�̠�qӕ��?n7�b��l�a�݅�txb��6���2��8�8���k��υ �i��(ۓ��) *���f{*=�<<�=.oh�g��� {"����,$i1�(1�шg��u�]4w��6~câ�ذ:˝����$�η�se~o#�� �l���3$sf��b�3����\���(r�v���9$�p^r^%���k=_�=g|�=h�>�y� w@~��6s�|�q���7!?9�i�/�v)�2�z=����o�3�{��'{��<[!s{��6�|����ޅ�(�2�v ˭�'���5�7q���!;p �p�> ��f���ob��h�؜�ːh��蝌�,?m�#j���,܇��q���(o����s��7�*�*�c~��_ }�ѐgc.�u�w�j��a���g�!\� :,?c�b�ќ��:�k!���nnc�x�w�| �b����|=c��e�j�u����/%^m_d�;v��%�p � �*❬)=� ���s���\g�.����'>�k�s,k���j�π�z��y��!tf�~n<��s�^[7_�e�_��c������xs���z��2�bs�֗z`�m���l#���d�=�{�f�vּasiv�����ri���_��s,#yg|f�j���%ĭ/��h�"� �w��?����(1�|�8���ߴ5�e<na�ލ���3�z���w�y����q��z���v�݊�(�d�go�d���9[ ލ���� ��4c.ꖣd@���\r ���з퐷2z�-܎�lwp�����1h�9�� n_�ޅ��am5����հ��g�<��`�u���p ���>d�~o�q�9���o���y�5�`�� h�� ~�~ �q�}�k(���~ ��2� ��6j��t?z5�e��g �se�d�˒�>���9���2�c�nz2�{d��6��%ehazxd�e��l����0<�~�}w�bݱhy|�#���o���uǰo���np���߄�71b�8�(#��wy��ay5�<��a��fg�ȃs�h �1˜�~��%��?_ 9p����%��c.�st�#f�r���4g �� `���u)�u��h9ղ���������2�w f�|y�w�� .w�d�pl�q�?�um!=ǯxv�x���o�?�� �ױ�v�[ �z�qk��p<�0��c�g��ȏ��>�8 |0�b8�������{�e;x���o"su/��h��,�3[��g0�[!�@�n#g�坈�r#��y���ס�|���s��g�t��w�3�93��r �ml2�vyu?�xbq`^e�%��|%#m�b ~j|<�媃v^�o��"�sd~�i�r���g\ַ7 |����9�!�dp>�~�x�a�o�lrf�~�1"�cd���&g b�!6َe�������1�2�g����v/��|�@�>�vjk`a-��>�g�^���&�$�%�f��e[�6n�ճy�l����دbk�/q i5�^�_�n;e�ӷ���%�h�o���6�d�� 7��d�6�56^�w�l���)hy&����g��p�",� �y#(e� n�c)tjp� �����(�.�r<����c�y;p�����5�z��m�ti�˝��]�$�!g*��j�v���$�-�g%�h*�cb��c*��h� ������������:���9�����s�9ǜs�5��z � ��y�q�@���zn�f��ų�dx���f|��`��r���w���_����x�^ywa���ny���ej=#��b_��z�{s2/�n^��m�"����~99��ؗ�c�_���`6�d�k���av9����(-. [�!:a��m��͒�ry�az�>k��`:����n�ȉ�=;9o���[itǡ�"o��l�9��)~����h?}y�;����9/��t��<��7��5!k�<�9栩l��y†� �)�q8�qf��ńc�˧�uy4�e4ac�c�ç�(����^����w3�g�c���q|^����v�z��w��e����i6��/q<8�/î�;j9a�=�1 �{rv��9���pύ9�n�l��k�y6��'@��ő?�s�i�e���'~����>��~���������?��-����9|�z�'����s�� _�9�ez���\����͈ܥ&w��]jb��d՟&� ӄqpo6�v��h:��d�b�%k� �:���zrvv��i�쀹�|?=͚����;f$�d����}_4a_-y"r�_maf�"�#huގ�y8�%��4�>xbi �ي�����8;��&g�d�nyxg�u��%�9-#��fܥ9>�f���6 z9q��)}�ք ���kxs�ԓ�w�d� c�[l'9����3�� ys�y/ˣu�&��%���_�jb�]z�"/�se��._�`\jc9_/�|���β6,�j� k0^���}&��<�5��2�xn�c��wd~$�"|�n؏�p��w�ӱ�p�쀢 b2�b��/ ��'լ����f�~�ʎ��`9��,��{����k '� ��7a �>�8ɺ5(磷x��q,�g���i?���xa�1��h�mxk �)-�z7�%��o/��d>��gf�)�qz�y3�{�ȯnd)�iiyvv$��6���.nou'2�)�c�����";�y�p91�����v#��̓�jn18��.�t�w�f����4������ 9a;ٵ�dd}�oiװ̖;�,rcq\vdj��3�ש�[psl��.#m��$˅n������/�6η|�̥��2:e��to�����9��ho�vh*"���_�}����h���8�o�s�?�����?����up�ٲۿ�\$��jݭ�m�l)m俇�i�ʈ������ev3��м(��ө���x{y|����"��lyh'�����|�<�����a,��a;3[��8��q������n'n���2.ϐ�nj|�^� �՗� ^$o�����<%�d0sz�n��������s�� �4��h��үvҫ�"���f��n �r���_b>� n�� �������s��� "?�����=@��� y�w}8�6�ž�� �?��� �*�h��:� w��ׯ�� ���dj�.b���o��uޤv�%j��v���܉� ��e�}���_��w�?g��� ��_oۚ ͯ�;_���ɺf�٤����h���ym��qķ,< t��%ٝ�w�r �"��3c�f����3�m�=)�o�w��b�te"�d��9o���yp�� ����>f�'���������\y�� n�#`1h�a8u��8�4��f�j� ��丼�>n�kh��{��9�b�rexva�!܋&vd�d{n��h��s%4p ���iϫ��ai�[as�������6.��2��g���=~n�� ��~6qk"��p!��xc��q�e���a��(�����# �n��z>�\4�id�zb7df��o`���ϭ�!ύwr��xf��x�� �f�|刬2z�,>xv�h��9qn�tj� �g$e�}��j��d �y��`(����*�8��`���i e�wj� l�kp��&�g��m�ډ����i��f4 �\r�hf����"��8����@�� ��~���� �� ��jl��h� �g9=�l'�_ ڋ�\�̬��߯�'���t�!�#�ȗ��������`>�h�!�k-e��-� 1� \��#0�ȅ7�m)�(� ��q��hko_!>ќ�n�o���m�d湣�eg&{o�����$�����hȇ�%~>�����}*6� 3�b��cg�п%u}��(�o�}��,ehx��_����|^���k�g�"ʓ]��=-y����1�����j�����������<���ai��~����qz{-6e��� ��/%�k����0�!�k7�� {��bk>�>��j���†o�}�=)i����}v�����`�a ���2|;�7��,��,��y���ݍy2�j���ǒrzycb� u� �c�!�f�7�jb����������ս8�c�wo���x뎇���r�k�����x{f{�d��-d�-�_�g�f\v]9�/�12��3�� do �|ȓ���q �؛���n%�f-�'�%;b���fl*^9�>�&��ܚl�-����}���0��g�e_��qz#!�^p�ҍ��|�&�y5��p��ai2'��mp�� ��d�w>y���o�dǯ�\'��խ�|=����ݡ|r�$ȕ~�>�[�����ř=�vg��`t��ӽ�:{�k��n� �yg�a �i|�zbn*m7q��@�\��������~���|�d�����y0g,� �7�zm��v��z��l��.�yͻ�f��,6a7�v�� �g`k���3��n��<}��6ge/��h�ՠ�0h�f2\ks�xh�{�e�c ނ��q8n4�6��p�c.�t�q����b�bw"0)�q��;9�υz���>�zs�h�a�:�l�5e6k�7 �k�3r$c��a_e���!]��u`8q���6;{����� \k ����vgid��h��r���[�?��3%_�i�/-�)/��u���jy���d�z ~�ye�(f�ѣ��=ŏ�5f�ɏ\�r�(3�a�>μ-ȼ=�ǐϫ ��y�r2����0���3 �s 3���������id�$��l-v\,�ik�3:!����%7�a�*�r���p��8q�tol* � �?�z4%`�pw��b����0�m x?�-�f~�}�<��� c͑���|��6b��\��a4khoa�7@�l�ڢ� �p� �qx� 8 ���sw&�o�{�w4��b�q��b�7�(z��0 ���f_y��āh�up?�e�tj����{3�@3���p��ǿ�� � k�!�_�=��9�b�$<�}�2�w$�� ��� ��0j�g�fs�gd��o�s&�ƽ3���`ɽ�� �{`4�#[a��č �qw ް�uf�>�-4��=��"2u�ȭ�� '#g��� ��ȍk���f�q|ncn��4�� 6ys�;�0,�g.��*d���{�.g�8v��92�j�d��r�n�^�6lr�1j���zȋ��|���;�sp6d��z���4�p�fd���`� ~��&�9l��{ѐ�b�cvn�n��b~��]b��2�͏��(��l�ci��f����y � ج�q��>�k�cf���:�c�o��khսx2c ���bc.��s �/��k$�~zv�� �b�isd����gd}���^d�k. �k~4^��y�&��k�#͢(d�&�ޏ�62��� ��d�qf��h��� ��g��y��fqwd���s_!��dfk�=���b�ģ��=�)�ߤ.�i0f�;1��j� ��1����f(�ȧ� y�ԏ�ea�� r��"ޤi��������ۄys��a�я��,�)=) � g¶�<yr���o�m��1���li��x{vo�.fo�ь�z�4�3p5}l�������*9ݼ*��f�޻6��q}�;�4�t�vk�\5�w��dɻ���j(]{�ٹ�/s;��7���ʛ��c �w�'�-��@>��8��8�p�&�"����:��ԭ�����w�s�w��3�6@�ni�|�4,�p�o���l�fn\f~)|zjw���*oq=�7������}��般�!w�i����k��\�!w��re��}�6u@�l�3ܱ ��p���zki�1؜��\ �����9� �&�����w|few�ƌ�u!��$23�cb��/�]�e�t�b�@�@j�c҆�s�e�b\�j�������"#�:��og�x�ܗx����ҷ�hf����m5r�x3�o<�lj'ӌ���ʏhn�xh�-e���';~#"|͞�����cq �$x9.�b�y�i�i���{e�"r�3z�h�uq�t(3w� �d_���ȼ�nc�fj����{�e�k,c���vv�a%���qސ5�z'1< ��z��������,l�:��¢w�6>q��bӊ��c�k]����en�rz�1~~��3������ԕ���8���q�d������l��|yk���ǎ�%�������d2x���d��b�-3!�.g��<�/���4��ۃl3u4���&b��uy�y8�mq-�ҏ������)��������?i�w;t�7ud����o�/8�.���-�l΀��8�;��v �k�n�_b~ k��פ� ��0�-��' ���<�l6-9���{�h�ȋ܎��9�(�\����c�_��s" �fnhk�~-��`y�h<��ɉ^89����h�%v7�7��;ȳ#�#v �in�yz?�o q���m��w�6�a3< m3b8]�������x����w��d�mdv�y�ǝ�>�q��$v�z��(�iva>�h�����w4��׫�r��avgq��d��&��x���&�)�ѐ�5̐4"9�o�g0�k�#��y����r��l<yc�75p u��>���ʧ*�r���nv;u;�yݣ������&��j�������쌴��;�3�cp��'k�� ���p\_��3������a<�ed �6'�y��aaxրm�e���v�]�=4h������0���2����'�yp\��mp�s���߇9�h�c���� ��^�qa�g �� �aax�q�c�j�:����l;h�t��`o�f�,8dа~��x89[�3��.� �j�~��`�w�}�}xp��e�ï�ix�����l��� � ӆ�s7l [����sl ��08n���<�z�� ����6��1=|~ã�8<5txߡ�o�<�,�i�����cc��$,��0m��d�l[��`g�ʛ�ro��׸u^j����<~d���@�{���ť�ow>w�쩲����$��s��=���s��g�?m͈h�u���>%l��,��y��`�?�r��������k�v����(c�n������?����u����v��������뺧�anן�v�mj��q��y��r�j^�������y��y�*o�����{g����z����5z�ޯ��s��i6%mu���fz��3�,6k��{%es�t�s�7���<׳�p��)�2?�b���ӯ�nyyu}{�j��=��.���_$5�u�<�m�\ߓ�:o����h�<ם�\�����w\]~ݶ�� ��s]��n�u���|����q������ws���uu��$�o���������,�m�o��[q}�ս����׵�w���q�u�<�����:=��y�?�s�c��3w_� ��y��y�\mߠq�������գ��6g�"���w���m_�?�v�<�ffp���� s��=)m�n���r��;�vv?y?)����ei�wn{��e��v{��7e>h���xi]xqwoc�=&��y�]u��!j�ڣ���^�kc�kuj�j��m���.����������i��;�4�'��]�����nz������{�a���a�=���>�3ck� ��k�w��د��]��������� � �&,�������������#%�(������k ߧ��*����(ɡd��v�s�,��erptq-�jrz��qq�aw�еi���;e�z4|^��_�՟�z5�]� � ^i�:5��v�d��w���ey�t���3���0��7ӛ��yo�9����� �w^=�]�.�y25�|�p-�):e-ԅt!�h�e�s��.�늺�zzw���]gwvk�0=\m�#�h��e�1j�~x�w��d=y����4�����=z�^���u���g�ys٤�t7-lk�kڙv�6k�r�����{~�dxia���w/�/��k����c��^�`x0�k� fz�����^���}�����xj��vzt��)�����@��b�y���6�$��)` ڊ���l �b�z{�)l��j�z{����ښ��)bk�ڦ��k�b6ݦ�ⶁm`j�f��)i��&��mj��ҷ�mf���mssƶ�-ly�ҷ4�l[�֔��l/s����le�i3m%;�0��@;�t��� s�l��v�n�ّv��ng���;�n05�#�s�n�sl-;�n7��l;�ա���l]��}ܤ�'����g�t��.0��"��4���b��.�kl#��.3�� ��4� �js�]ew���y���ɮ��m3�ʈ17۵v�in������n0-���es�}žbz�w����}ݾnzۭv�ic������iw�v�m���;e�2��^��t�o۷������h߳�n��=`:�������t���olw{�2���ss���~f��/��/��=mz؟�o�.������g�ys�=o3���ۇ���\�wѻ�x���g��9�u��b�yl��%u��� �ktu]u%�,t���a_�� ���af��l0 � c�!�`0,� #���-g˩km[���j��*b��*���j��b��������*ak�z���c���@��j������6� u��6ve��fu��dor����f��$�v$�v�mlu��k�uul��p������j���j6�f���!����f�lu���tm;Žp��(;jն��xu�n�u];�nviv�����v�j���,u�ζ�u;��u ��i��η�uc��.tm�s�)u�}�>���r�t�d��媙���������c5���g�-�9��ja��ϫ[� ��ү��t ��}i���f��n�o��:j�k{� ie� �����1`zキ�1`� c0b -�^c5��1-z{j��wu-$�}�����9��� �>s�>όd���u0י�xes���u27�yes���u��w��_5̝�xu̝{x 3�gms?f�z�a̶��_0��1�`��k�,[�<�y��y9��y9��y9��yѽ���|a>2�&f�˚�oͧ����|n�^�� `!�k�al�����0c��w�3�w�3�,�,�y����;���ї��/��� �q���;��c1j{��ސ���rj�� �r����x�=��^�,���l ��~`?��l�ώ���*�˞��g��փ w7w�� ��]��f��&���m$.}c6�՗lww?�q��d{��펟h6�5�lw�`�q�!d{������ '�a���[�q��d{�f�큟c6���d�\���p�f�fc��5�(�(�{��l ϻ�&��|o#3�ff�����6"�ld�ۈ̴�e#2�fd���\��6" ldڈ,�yl#��fd���2��6" ldƣ��\3�y���&"�ld~�ym#��fd���z� v��d#��ff���f�-62[md~��n#��fd���.��6"{mdbld�و�9`#��yg�����o"r�f���6"gld~�9f#r�f䄍�i�s6"gld�ڈ��c弍���62�ld.��\��f#r�f䆍�m�[6" ����i����&"wld�ڈܳ�o#��f䑍�c�x�'6"omd�ۈ��yi#g#��f䍍�[�x�;v�%"��dd4hdf��h�f�6!�yf���"�� `�i6��g�lqetmd[�^t�dw�c|%���b�.f�o�h_��uqc���mqg���}�@<��c ����x��o�f�#x����ʢ2㢚�ƅh-˜"ډp�]ew��"��d��b%�s�d��-z3c|#0��*�2�qb��|�|4ː�ij%��ni�dp2*�j&%���� ��9ͮ'�{n"����8w ��od�?�ӛ�qs|�=�y��l��{���u�)ɕ���ri��v�񳿝��@�$u|uq(rq*.est�p܊�x)ފ5ߥ�o}�"��p��r�ji�$3q_~�'�eb�x!v��b�� b�>�_š�!n͖��b>q����z"� ���qdn'�視�����skp�f�il[�v��&��b��ژ��@,��/��b���x��3^�!<��u�����g����u3�{1��{v4����| ��al0†�aدg�o闫g�1�;����x6�md߳il2���l��f��l��`.���l![�c>x–�el9[�v�u�v�5l-[�ֳ �'���f��me?�ml;f��l�����,����q�|-�ȷ2^&�wn�9_.� �"�x� ��g�|!_j=���^��zo�����w��ע��@m�6x�z��ѿ������z�>@�և�c�a�p}���>r�����s���4}�>c����g�s���<}��@_�/��?�k�e�r}��r_�������k���m�v}��sߥ�������!���~d�u?�ӏ�'���i��~m��������gz��t�?�_�/�8���z����w3���0c5�5�qøi�2nw���=���xh<2�����xn�0^q� ���xk� �;7s����[q�n�[��n�[s�n��v�n/��;�;�����n�n�n��s�t�r�v���i�i������݁�l����i�����y���9��y�����et����i��/��1����lq ������~j4���t4c�m/�.� ���ן]c�xvml��ub��[7��no�&޺#։��.1�}��r��sus5�ު7�{���&ܖi���6d�ʹ6_�����iq<�f�[�|�d�'���x��j��� l�쌧�1n��dݣ�fə���o�1x���a}n?�᳧pi;s���cipdo�{������>�_���~ ����f2�fr�f �t�x:��{4.\�mjx�5�o�x�oړ�=~�'%�ie{8sa�y��b���ya^�q^��c�w��«��l��i�c[��gr{�=��qu���ı�2������ð��u��orfr�z������@s�eάblv�i�d�h��1�/�b�‡d��ȃ�1�����~`;��i���bit��ht��㕭;ޠ�h��ci���8^c���hmf��{��>�m��hb$5| _#���ha�)�tfj��0�i�tfz#���42��,fv#����l;��|k�l����.�#�^�����w����, �b>���/����la���oy9���l��)�t�;��f��;w�p(� �2_�uxf���b�m�-� ��b�tb� z�p� x��ysx �ykޕg�><��a�x_ޟ ��6��#�>��e���d>�c��1� a��l���l�h.���"���6� q�m#�?n��fo'�9�avwm�&?���r�qj�r_��!���0�hp�v�� � �i��1�1r8f:~�<���5pرα�8bg����$4u�q��f� �k��a<�9ޡ6���ea� ���ՙ͙�;s:��ng�3�:�;�c���� ���~g g 8�,�,��������"�����u�u�����>��l�lg�͜���3��]8�3zk���´vp^k�e�e-j��{ȳs�>����y6t�7�ro���-���u��=�=��l|�g���khcoy��`�����qӄ���x�z9���d��-��\���z�&���� ֯ �b(�<�gr� ���`=e�z���Ԫ���qӫ���j5��fr3�yԬj65��cͩ�rs�yt���y��pn�i8g��� p.�e�w�\�pn�m�w��w���⥈��k�f��"a��w�)��i�a��vhbs?~x�ǣ ry�ӝ�z.-'�zub, �egexyf��xlv�k��>l�%)k�ň���˺�h��}�z��/���;9k^��rcm� �ai�阴�_k�t�_��tw7�ԍ�:�@z^&t�(��@���`�#�[����{�� {�z���v���^� �k�m!��򓦮d�nmi֩����]�\x.d*�� t����c�2� *�j�*�z�*���>sq��1*���jùs�v�tm���yk���,�vr;œkg���o��]c-�[���g��-f`ِf�vgy0��da��/�|��/���ï���o�p[�b1��a�0��c�1�?��[��0��/�m_r�/i>� /���<��e�h%���1i~9q�}�\�f~�ɯ�䗯�\[����c���t�c�v�e��i��/����iy��< e���ヅ8�(n^�%��#/�`����qdbyt����v��ٚ<�c���߳[�erh%>l�pr���a� ex��bd�6v �" '��b�ۄi��n�nfn��֐�82��y��k,��xm*��1�:�m�~f�q$���b�8�b�ja ��`)�f�_�& ןaө�7p��� ~�m��d��"` e�v���)�!�?bۑ�c�d�x����~a���n��i�.����n�*��ctix,r|*`&�җ�y#hvʚe`5��xm�k�,����)g�[�0��h�yqw����"������6�j��s���lhӵyx�mz f� ݊_�j����iow����,���̊�lfy�q�c��byh�<�<$)9)�(i��t�c�!���!o�ci)�p�<���p �c�3v�� 6"��>  ��uf�� ��t�zxu-�=t�(�.�0f�x<�,xk�g�[a�#��y��6<�g����<)��ix ώ����}v�"�f�~�m�6�bd�aa�͡�p�lk(f�'�{�eà$�6p�l8�#�ղp��5�e�u���jj˚o��eu�ay�<����iv�ӌl�ӛl�3 �wτ�e��c���y�c6�^���rb������k�a�1���u ȋuk@���ú5��: `�jy�~@i�;@y�;�^��u��@e���jxw�*xo��xo�jxou}g�a�^�f>�8�a�s�j�s�z���谞frj��n��9]��o�~��y6�u_ �vd��ͬ��ϧ�yl)[�6#�d��y��ǿm���h��x�x�@~(��t�a�l�~�a/~@�� bk�6��d��2��`9�氂lkxi��"�~$�v� �5d�8,�>��,z���g:�[����;3�mpf$��hy�8��0��o&��,j���rs���r�ͣ6�o���zn!��"j��v{8} �d�xrb<!�g��$�s� qb����na��qo/�_4��xw�g곲`�b{& �s�����mr~xjge��{1�l�x�ںcޘ�$�w�l�)�x��dža]� �ԃvzd�f��¼;�����x�h�5������� m�6k�����j�0�n�vh;�]�nm��w�1_���b��ô�s{����ho�x-a{�c�ӿ�������}���>i����������&}��eߪ�������u��~s���������cn�eh�n��0 /#����e�6�#�6�!f>#�q�5 ���f��q�(n�0j���f��i�n�4��>��g�2_��mӻ��f}�fz**���i�ygd�h��������i�7/�y��k�j�bi  ��c�c=k�x�x�� �*,�5va}sq���y#t3c�� �}- ���3� ��ϱ���ո��w� �i�]���6qw��������w7������-���s�3�!s@?7�f�e��������mfh�ǥ�cj�1�<�e��'�k��uh��o����^x�y�x�����q���;x�$)�"ep ;�=mjo/jooj�$ԟi�=}�=}�=�q{&��la��g홒�3�[ �ھz]5?�z���c�>oq�(n��s� ������w�p�|��{:e��*e��hv&�b!^�[ $��yj��g�vj��v w����fz3����bf3s���)�ҧ�)���[������oj��=�ӂ��ii�����b��x�t���&�dn�e��"��peס������&��l ����9l[�㟍lۃ#���4��{���u�tw�w���$ύh&z�v� �%�уu� ��9���~‰�=.o���3p��a-<�����'�m��.��węop�-$��;n�����d��ei��ss7�����16oʭ��%��q9��9����e��3p��@����l���~-(ρ�9yn\��s�rnn� l*�����4\�χ�� q���[� qi��ޘ���j*����rjy&� j \n���r{�葫{�rou .r��`u���ku;.�pbfvrergfw��.tz�n�� �?�q��^�ގ�;ܻqy*u0ӡ��&�����ʚ�?��2����3�7 �a�4|��@h�i �a�4�� @h�i �x����r"@jh�) %�d���r"@jh�) %�d���r"@jh�) %�d���r"@jh�) %�d���r"@jh�) %�d���r"@jh�) %�d���r"@jh�) %�d���r"@jh�) %�d���r"@jh�) %�d���r"@jh�)����𶐀�h}i �������>����n�|vt@4n����c�a �je�-��.�a�u�sӓ�-�s����9exu֒uc�d�x$�y�w�y�t0��v���o�?i���w���r�ؚy�~�=��vo�x�n� ok���oѭ]x綑���=��q��za�;etn���om�|�u o�5�[d��t�#�v���"2��ޓ��/|�~�_'�sx�ڑ-:uiw�tio��aoppp�� 4�ղ������� wfx4k��#jv/����p�]��a��թ];]��� �)� �t�r�b�� ��ɘ��g���5*�u�'2|�/�ldc����`��v%d��3/�����eݔ)b��k�� <^�l�\��q�ⅳ_������ȁf�voٻd߷i��n���ʻyǘ�x�= ��z��6ϭ�iҟ� �c~��ك�,���^�/.��ߎj�*ͻ�e���r�gʊ���c�q���x��o�oo�w˛ejy�c�o3�4��*e��]u:��h���=��}�~nǽ��_cƙ29}���z�)2�c����4/�w��&i �=����n(��ӵ��չr��{��hp!"�'! 0q���j�yt�l��n;`b��=��<��ep@f�ύ��oɛ�3��u��x�fu��;���ա>�v���8�����k����r(o�v];�����r��蔧k�pkk�.]#zwo�-χf�z�c27~�����n��@����~���oуg�ϝ ��?8r��ǻ�l���!��w�qxq2�}ߧ�^�uϲ����qn�ػ4|��#�[u�� ��w�s���v$w�s3���=[8ר���&�=?:�a��<~=��p���j��i��qɰ �z����ʜ�����g�~ ��� �5�n~�h� ��q�'��]��n(��%�hv��� f`�ť\ͽ�����jw)��n�]f��7�_6k��-�e�cy���p����?��o��u꽞� � \�ϯz�\�/��|p�u��.^���j��֋vk����k=�6��fm�$��%ud�dn��i?��:,]���vk� j�e�р�`� ��~����\��_��������s����do37�uh����~?tb��s4��p��i������ѱ�ׁt���r�vo~�f x2h{����'m����w#k�������_ۘ��>s�] �r'���ee]��۷��l6d�{�mb����4~�sp�i��r��hvy�����;�3a��e͇��s��-��y��uc��\��x�7���r��4����@_gt�e��dz� u��|7��{o����ڠ�'�x������o�{� ,�������v�a?n��@�l��? �����>���٨"�;1�d���^��=u|���l9�p�wߵ���јmk�����e�n�`.�w�s6����e�z�f��o���������h� i�/�e���-cr�� ��7p�֡��ڴ@ i��x�s�5�c�?�(p ��n��w��<~6cet�fy���؊�fv��s �'�r`��r`]j��r`�z��y��"�cx\����,�q��h��\�5b2v�s��q񇶜��*u��c�˫'v������% ͺm-�sy�wc7�yrn�=^7���{��<.�5?y��aׄ#s��x�o�wc���s���9�a����wd��}�t���|��g�����ky��� v,�������f�[�:o�zm��}�j}7���^���o,�0x@����w�qx�*��o8��ܝ�qp��'.�7��ĭ�����r6�����������i�;m�eo\��1�-�w���o�������.aљw;7|�ߕp�w�$���|�}i���~k �9�ȫ�ӌ�<�;��ș��� �xo�j�o9�wi?m\��y��k^�t��bg��}au�y�;��yxզ�t������̼��d����u*��{��e��n����z�z58��|ˣ��-� h��x��"��(��̘��[�i�bo�!-�͘� ���l�=��� =����ĩ�-�] ��/�v��c��)�oz>~��'��c�u��w[}�q���]����� ��4�h�#�c�|��;#*�أ]�s�v�� �]���$�$�(���ۅp�����mf�ts��sv�u��u��w��)�l�zm��k,��_�@���.��ʲho�$��:�u����哾�d>�:��z��a�륩lz<�`�y�l�η_�p�v����g���벇]g��8���2�ղ��ڞ�z�\핃���z.w����׭e\9ߴ3��y�ӆ��)�����8>3��tʮ��7j�kg{��ىa�̐2c�pl� ih0�ǚ$�[��y�rq!�3t�<��/~���-l�z� 窇%�u�m�"dd'i�p��;�j��b���x����*s�=1���{ }e��-��0п�����.7ܷ07##��3�oloԁ\�wߌkpc��j�ǵ��������f���g' (���y�y�e�cra��i�e��� @�y��c���}�vs(}� w� �m@0���6 ���=��}�}������!�oqf�?84}�,��c�3p<��v�1:���w- �qcyd.�������:d�j�0��f�����l�����,j.ol^<���:m�y�,�t���d�����,8�������9����5�����g�f<��3/�i��)�v"�#���3!_�ba#���~�����™vy���7�1��}֡����:���x����滟���@st�\=k�s�|�b���]z���u�f� }�ʱ��䌤�g��^��y�܀�c杏o"ᛥm�t�h�d�����7�4\� �t^9���ȑ�$����s|^ e��� �wu�=ocl��t���i兘9#\���s�p %��ad���m���ވxtdϣ^~{'�ǵ����)">f�~�jur4�m\s�ղ� t��?x�(���; �rz6q���0��be�*h�䷈adž�2���7�`���g,xȟ��`����j�by����n�y��.�q���-0�hy��yu�u{��cd�p��a��{y���j�`~�no"'����cr��\��i?מ�u%t����x�v����� 1m�dl)[��s�,a�|bӯv�g/�[z�^rw�.#k_�z�y�`��=�{�����p�;c q����dxdc��ۏ��<�fv2עb_�w�\���r�fwfv?լhr�j��z�(�h9�xk�ck��g�^�fe%���鞜x�w�v��*{[ԃ��x�^�.�%�h���p��b�usrڹ���a{�v��锖qݛ�f|�ɩ�˷�h�̺��a�%��u�7ѵ�_e�%ű���/9��}i[�֗b�n�� �v�ٚl�q��%q�;k�ol4��f� ��ibf������y��y3ptrid�)��>t�3�l�e� ̙l�d�`2׋b|c_����u*��bչ)rf��9t�l�b��!��ѳ����l[� ����?�`�`.�ҳ5-��? o�1�k��q^�$f��hh�b�������7x~7.ٵձ��!y��a =��r�op��*�c)z��g2�)jctk&��m#�ja6#�p)�c�-]�t�n%n�~7e�m̹nü` �oü�a����6.^�gpi.uk�� .��}:xp�� ���=o������ 9 � c�[@�"�b� s�7�� ��b6s�� o�^�x �}3���6�,.&��@�w�p��� � � �g��z^��͈��r�4{��4wzb��q����7�/�?�l�p)$�xǧ�\@z�r\>�#d�g�'� v]��5yತ�� ���#��ʀ�:�50q�k���)aq�� ��� (f� �������rzr(oq6� �̌����kh����] *o���ze���z�f�3͸4�yd[�w�-�*>vʽ�r�>��{pv�u��� g t�oh ��x�^vp�ϭ<��\t֢��|,'��ׂ���ߥ��m>�'x ơ(╶�w~����e�� �0�lieq��-=�s!�k��sg܉��9m�h�n�pq�fw���v36��q��{ ��s�3ad��%b!��ov�hh���t�e)���ڵ��(�5�tђ�����rw��m�co�1b�3���;m� �$��_s��/�a���?l]�m/����=s5�s��-�b�%(^e�:� ��7: \�) $�v�fwu;hn�x��oؼ�4�x��ig����]�pe 6|�k�-�h��#���z���!���ii�����hd ���t$�!ׁ�0��q�j�'�\��� xy�;���m=1.`i�hh!������{��oa-x�t[�q��'��p4 0�q�_s��\�sy8��ϡ�h�w����|cn�:�l'(x� }{"��1#�z�i^���m�i`�v�d�v^�o��„��l(#t���,�f�0.���8j���t��ն�?�l�"z��u���]u���x���ཤ �ea���:f711z5��8�;�<����8准�r��h�.����x���ڨ�w��t�ki;��d�i2ȋ�~�e5f�(8>�v����[b��h� ai���w6�k�0���� ��ɓғ����us*ya'?mc�� ���"a ���] tg8�|����e5����]�[�^����qut<���y�p�h �ޑ}���@�x��y����(�et�{k[��7 hx endstream endobj 908 0 obj [ 0[ 507] 3[ 226] 39[ 637] 856[ 267] 1004[ 507 507 507 507 507 507 507 507 507 507] 1081[ 729] ] endobj 909 0 obj [ 226 0 0 0 0 0 0 0 0 0 0 0 0 0 267 0 507 507 507 507 507 507 507 507 507 507] endobj 910 0 obj [ 278] endobj 911 0 obj <] /filter/flatedecode/length 1774>> stream x�5�ؕs���de{g��d�4��6e����if� ��uf6��x��e��3ef69�������:�s�u�����j�zy�"�놕j 㰰�v��f� �؂& 0���l�܂f�1��y= .h��z���v� zo/hӷ�m7,.h�������� � ,�>��g�.�y^�w�������zu?j��cf`$�þu* up�s���f�/nu7�p�b%���x�c5��z����&�!�*�f�h��h��h��h�h����� ��m�b����>6@�7���m�)��v�[�_���]��bkl�o��cg숝� va7|�聞���ݰ;���c쉽�?��@ �` �p �p�r����g���p0�(�ơ�7����_�s0g�(��8��8�p"n�ɸ�p*��4��3p&��٘�s0��<����bl�d\�kq�`*��r\� q�����:\�03q#n�͸�p n��xw�.܍{p/f�>܏�����x���s1��1<�'�$���x��m<��"�c^��x�w�*^�"��7����x��=���!>�����3|���_b ��/|�� ��{��?�#��'��_� ~��)˵�-� f��q�_�4�m�6f���)����hcd0�m��e�"�q��_�/�͉rf�"uѿ�_d1���re�"g�h]�0j5�n�x��c%����u���1�"6��(ed02� f#����g�>� ��`d0�� f#���(wt,�q�(f#�ňbd1���e���&d1�q�(f#�ňbd���e#���n#����`d02� f#���md02� f#����`d02� f#����`d02� f#����`d02� f#����`d02� f#����`d02� f#�q��`d02� f#����`d02� f�cq�h\d8�q�(f#���_��d��a(�i�#��b����܉�/j5��e�x��hc�1�m�d ��qèa�0j5�f ��qèa�0j5�fv��qèa�0j5�f ��qèa�0j5��f ��qèa3����w]�q�j�����.5k� ]˅_�ԫ� �.v�*x�au�c}��5� ��f#4f4e34g �d �f�e;��:x�a}l� �6fl�m��as�y����%:�7z�'�` t����b;l��#v���ݰ ��vg솽1{�/��?���81�1c1 ñ��'&*nlk�*�1 ��<���q(>�'��㈂���ga ��i8'�h��18��x���8�1 �t��i8g�l���1�`"��y8�b\��p .�t\��0s1 �� \��p ��u�7`f�f܄�q f�v܆�q��]���^��}�e��<���0�x�u��yx��q<�'���3x��y��1 �^�b��w���{x�����[x��]|h��1�st>��6)�k_`1��g���k�_�k�9���{,�z���'��_� ~����/��d�o� �xut4�5�f ��qèa�0j5�f ��qèa�0j5�f ��qèa�0j5��e�"u��hc�1�m�6fl��qèa�0j5�f �yܩa�0j���_�/����e��ѫ(^�,����e�����p�7z��(f��ѿ�_�/����e���q�h\�w'x3z�~q����z�f`|��e5�4�`pw,)r��p{���l�s0��u*ωj� endstream endobj xref 0 912 0000000038 65535 f 0000000017 00000 n 0000000125 00000 n 0000000209 00000 n 0000000532 00000 n 0000005333 00000 n 0000005463 00000 n 0000005491 00000 n 0000005648 00000 n 0000005721 00000 n 0000005970 00000 n 0000006024 00000 n 0000006078 00000 n 0000006216 00000 n 0000006246 00000 n 0000006412 00000 n 0000006486 00000 n 0000006743 00000 n 0000006918 00000 n 0000007157 00000 n 0000007337 00000 n 0000007581 00000 n 0000007756 00000 n 0000008002 00000 n 0000008168 00000 n 0000008398 00000 n 0000008703 00000 n 0000013337 00000 n 0000013652 00000 n 0000017599 00000 n 0000017737 00000 n 0000017767 00000 n 0000017933 00000 n 0000018007 00000 n 0000018253 00000 n 0000018568 00000 n 0000022477 00000 n 0000022812 00000 n 0000000039 65535 f 0000000040 65535 f 0000000041 65535 f 0000000042 65535 f 0000000043 65535 f 0000000044 65535 f 0000000045 65535 f 0000000046 65535 f 0000000047 65535 f 0000000048 65535 f 0000000049 65535 f 0000000050 65535 f 0000000051 65535 f 0000000052 65535 f 0000000053 65535 f 0000000054 65535 f 0000000055 65535 f 0000000056 65535 f 0000000057 65535 f 0000000058 65535 f 0000000059 65535 f 0000000060 65535 f 0000000061 65535 f 0000000062 65535 f 0000000063 65535 f 0000000064 65535 f 0000000065 65535 f 0000000066 65535 f 0000000067 65535 f 0000000068 65535 f 0000000069 65535 f 0000000070 65535 f 0000000071 65535 f 0000000072 65535 f 0000000073 65535 f 0000000074 65535 f 0000000075 65535 f 0000000076 65535 f 0000000077 65535 f 0000000078 65535 f 0000000079 65535 f 0000000080 65535 f 0000000081 65535 f 0000000082 65535 f 0000000083 65535 f 0000000084 65535 f 0000000085 65535 f 0000000086 65535 f 0000000087 65535 f 0000000088 65535 f 0000000089 65535 f 0000000090 65535 f 0000000091 65535 f 0000000092 65535 f 0000000093 65535 f 0000000094 65535 f 0000000095 65535 f 0000000096 65535 f 0000000097 65535 f 0000000098 65535 f 0000000099 65535 f 0000000100 65535 f 0000000101 65535 f 0000000102 65535 f 0000000103 65535 f 0000000104 65535 f 0000000105 65535 f 0000000106 65535 f 0000000107 65535 f 0000000108 65535 f 0000000109 65535 f 0000000110 65535 f 0000000111 65535 f 0000000112 65535 f 0000000113 65535 f 0000000114 65535 f 0000000115 65535 f 0000000116 65535 f 0000000117 65535 f 0000000118 65535 f 0000000119 65535 f 0000000120 65535 f 0000000121 65535 f 0000000122 65535 f 0000000123 65535 f 0000000124 65535 f 0000000125 65535 f 0000000126 65535 f 0000000127 65535 f 0000000128 65535 f 0000000129 65535 f 0000000130 65535 f 0000000131 65535 f 0000000132 65535 f 0000000133 65535 f 0000000134 65535 f 0000000135 65535 f 0000000136 65535 f 0000000137 65535 f 0000000138 65535 f 0000000139 65535 f 0000000140 65535 f 0000000141 65535 f 0000000142 65535 f 0000000143 65535 f 0000000144 65535 f 0000000145 65535 f 0000000146 65535 f 0000000147 65535 f 0000000148 65535 f 0000000149 65535 f 0000000150 65535 f 0000000151 65535 f 0000000152 65535 f 0000000153 65535 f 0000000154 65535 f 0000000155 65535 f 0000000156 65535 f 0000000157 65535 f 0000000158 65535 f 0000000159 65535 f 0000000160 65535 f 0000000161 65535 f 0000000162 65535 f 0000000163 65535 f 0000000164 65535 f 0000000165 65535 f 0000000166 65535 f 0000000167 65535 f 0000000168 65535 f 0000000169 65535 f 0000000170 65535 f 0000000171 65535 f 0000000172 65535 f 0000000173 65535 f 0000000174 65535 f 0000000175 65535 f 0000000176 65535 f 0000000177 65535 f 0000000178 65535 f 0000000179 65535 f 0000000180 65535 f 0000000181 65535 f 0000000182 65535 f 0000000183 65535 f 0000000184 65535 f 0000000185 65535 f 0000000186 65535 f 0000000187 65535 f 0000000188 65535 f 0000000189 65535 f 0000000190 65535 f 0000000191 65535 f 0000000192 65535 f 0000000193 65535 f 0000000194 65535 f 0000000195 65535 f 0000000196 65535 f 0000000197 65535 f 0000000198 65535 f 0000000199 65535 f 0000000200 65535 f 0000000201 65535 f 0000000202 65535 f 0000000203 65535 f 0000000204 65535 f 0000000205 65535 f 0000000206 65535 f 0000000207 65535 f 0000000208 65535 f 0000000209 65535 f 0000000210 65535 f 0000000211 65535 f 0000000212 65535 f 0000000213 65535 f 0000000214 65535 f 0000000215 65535 f 0000000216 65535 f 0000000217 65535 f 0000000218 65535 f 0000000219 65535 f 0000000220 65535 f 0000000221 65535 f 0000000222 65535 f 0000000223 65535 f 0000000224 65535 f 0000000225 65535 f 0000000226 65535 f 0000000227 65535 f 0000000228 65535 f 0000000229 65535 f 0000000230 65535 f 0000000231 65535 f 0000000232 65535 f 0000000233 65535 f 0000000234 65535 f 0000000235 65535 f 0000000236 65535 f 0000000237 65535 f 0000000238 65535 f 0000000239 65535 f 0000000240 65535 f 0000000241 65535 f 0000000242 65535 f 0000000243 65535 f 0000000244 65535 f 0000000245 65535 f 0000000246 65535 f 0000000247 65535 f 0000000248 65535 f 0000000249 65535 f 0000000250 65535 f 0000000251 65535 f 0000000252 65535 f 0000000253 65535 f 0000000254 65535 f 0000000255 65535 f 0000000256 65535 f 0000000257 65535 f 0000000258 65535 f 0000000259 65535 f 0000000260 65535 f 0000000261 65535 f 0000000262 65535 f 0000000263 65535 f 0000000264 65535 f 0000000265 65535 f 0000000266 65535 f 0000000267 65535 f 0000000268 65535 f 0000000269 65535 f 0000000270 65535 f 0000000271 65535 f 0000000272 65535 f 0000000273 65535 f 0000000274 65535 f 0000000275 65535 f 0000000276 65535 f 0000000277 65535 f 0000000278 65535 f 0000000279 65535 f 0000000280 65535 f 0000000281 65535 f 0000000282 65535 f 0000000283 65535 f 0000000284 65535 f 0000000285 65535 f 0000000286 65535 f 0000000287 65535 f 0000000288 65535 f 0000000289 65535 f 0000000290 65535 f 0000000291 65535 f 0000000292 65535 f 0000000293 65535 f 0000000294 65535 f 0000000295 65535 f 0000000296 65535 f 0000000297 65535 f 0000000298 65535 f 0000000299 65535 f 0000000300 65535 f 0000000301 65535 f 0000000302 65535 f 0000000303 65535 f 0000000304 65535 f 0000000305 65535 f 0000000306 65535 f 0000000307 65535 f 0000000308 65535 f 0000000309 65535 f 0000000310 65535 f 0000000311 65535 f 0000000312 65535 f 0000000313 65535 f 0000000314 65535 f 0000000315 65535 f 0000000316 65535 f 0000000317 65535 f 0000000318 65535 f 0000000319 65535 f 0000000320 65535 f 0000000321 65535 f 0000000322 65535 f 0000000323 65535 f 0000000324 65535 f 0000000325 65535 f 0000000326 65535 f 0000000327 65535 f 0000000328 65535 f 0000000329 65535 f 0000000330 65535 f 0000000331 65535 f 0000000332 65535 f 0000000333 65535 f 0000000334 65535 f 0000000335 65535 f 0000000336 65535 f 0000000337 65535 f 0000000338 65535 f 0000000339 65535 f 0000000340 65535 f 0000000341 65535 f 0000000342 65535 f 0000000343 65535 f 0000000344 65535 f 0000000345 65535 f 0000000346 65535 f 0000000347 65535 f 0000000348 65535 f 0000000349 65535 f 0000000350 65535 f 0000000351 65535 f 0000000352 65535 f 0000000353 65535 f 0000000354 65535 f 0000000355 65535 f 0000000356 65535 f 0000000357 65535 f 0000000358 65535 f 0000000359 65535 f 0000000360 65535 f 0000000361 65535 f 0000000362 65535 f 0000000363 65535 f 0000000364 65535 f 0000000365 65535 f 0000000366 65535 f 0000000367 65535 f 0000000368 65535 f 0000000369 65535 f 0000000370 65535 f 0000000371 65535 f 0000000372 65535 f 0000000373 65535 f 0000000374 65535 f 0000000375 65535 f 0000000376 65535 f 0000000377 65535 f 0000000378 65535 f 0000000379 65535 f 0000000380 65535 f 0000000381 65535 f 0000000382 65535 f 0000000383 65535 f 0000000384 65535 f 0000000385 65535 f 0000000386 65535 f 0000000387 65535 f 0000000388 65535 f 0000000389 65535 f 0000000390 65535 f 0000000391 65535 f 0000000392 65535 f 0000000393 65535 f 0000000394 65535 f 0000000395 65535 f 0000000396 65535 f 0000000397 65535 f 0000000398 65535 f 0000000399 65535 f 0000000400 65535 f 0000000401 65535 f 0000000402 65535 f 0000000403 65535 f 0000000404 65535 f 0000000405 65535 f 0000000406 65535 f 0000000407 65535 f 0000000408 65535 f 0000000409 65535 f 0000000410 65535 f 0000000411 65535 f 0000000412 65535 f 0000000413 65535 f 0000000414 65535 f 0000000415 65535 f 0000000416 65535 f 0000000417 65535 f 0000000418 65535 f 0000000419 65535 f 0000000420 65535 f 0000000421 65535 f 0000000422 65535 f 0000000423 65535 f 0000000424 65535 f 0000000425 65535 f 0000000426 65535 f 0000000427 65535 f 0000000428 65535 f 0000000429 65535 f 0000000430 65535 f 0000000431 65535 f 0000000432 65535 f 0000000433 65535 f 0000000434 65535 f 0000000435 65535 f 0000000436 65535 f 0000000437 65535 f 0000000438 65535 f 0000000439 65535 f 0000000440 65535 f 0000000441 65535 f 0000000442 65535 f 0000000443 65535 f 0000000444 65535 f 0000000445 65535 f 0000000446 65535 f 0000000447 65535 f 0000000448 65535 f 0000000449 65535 f 0000000450 65535 f 0000000451 65535 f 0000000452 65535 f 0000000453 65535 f 0000000454 65535 f 0000000455 65535 f 0000000456 65535 f 0000000457 65535 f 0000000458 65535 f 0000000459 65535 f 0000000460 65535 f 0000000461 65535 f 0000000462 65535 f 0000000463 65535 f 0000000464 65535 f 0000000465 65535 f 0000000466 65535 f 0000000467 65535 f 0000000468 65535 f 0000000469 65535 f 0000000470 65535 f 0000000471 65535 f 0000000472 65535 f 0000000473 65535 f 0000000474 65535 f 0000000475 65535 f 0000000476 65535 f 0000000477 65535 f 0000000478 65535 f 0000000479 65535 f 0000000480 65535 f 0000000481 65535 f 0000000482 65535 f 0000000483 65535 f 0000000484 65535 f 0000000485 65535 f 0000000486 65535 f 0000000487 65535 f 0000000488 65535 f 0000000489 65535 f 0000000490 65535 f 0000000491 65535 f 0000000492 65535 f 0000000493 65535 f 0000000494 65535 f 0000000495 65535 f 0000000496 65535 f 0000000497 65535 f 0000000498 65535 f 0000000499 65535 f 0000000500 65535 f 0000000501 65535 f 0000000502 65535 f 0000000503 65535 f 0000000504 65535 f 0000000505 65535 f 0000000506 65535 f 0000000507 65535 f 0000000508 65535 f 0000000509 65535 f 0000000510 65535 f 0000000511 65535 f 0000000512 65535 f 0000000513 65535 f 0000000514 65535 f 0000000515 65535 f 0000000516 65535 f 0000000517 65535 f 0000000518 65535 f 0000000519 65535 f 0000000520 65535 f 0000000521 65535 f 0000000522 65535 f 0000000523 65535 f 0000000524 65535 f 0000000525 65535 f 0000000526 65535 f 0000000527 65535 f 0000000528 65535 f 0000000529 65535 f 0000000530 65535 f 0000000531 65535 f 0000000532 65535 f 0000000533 65535 f 0000000534 65535 f 0000000535 65535 f 0000000536 65535 f 0000000537 65535 f 0000000538 65535 f 0000000539 65535 f 0000000540 65535 f 0000000541 65535 f 0000000542 65535 f 0000000543 65535 f 0000000544 65535 f 0000000545 65535 f 0000000546 65535 f 0000000547 65535 f 0000000548 65535 f 0000000549 65535 f 0000000550 65535 f 0000000551 65535 f 0000000552 65535 f 0000000553 65535 f 0000000554 65535 f 0000000555 65535 f 0000000556 65535 f 0000000557 65535 f 0000000558 65535 f 0000000559 65535 f 0000000560 65535 f 0000000561 65535 f 0000000562 65535 f 0000000563 65535 f 0000000564 65535 f 0000000565 65535 f 0000000566 65535 f 0000000567 65535 f 0000000568 65535 f 0000000569 65535 f 0000000570 65535 f 0000000571 65535 f 0000000572 65535 f 0000000573 65535 f 0000000574 65535 f 0000000575 65535 f 0000000576 65535 f 0000000577 65535 f 0000000578 65535 f 0000000579 65535 f 0000000580 65535 f 0000000581 65535 f 0000000582 65535 f 0000000583 65535 f 0000000584 65535 f 0000000585 65535 f 0000000586 65535 f 0000000587 65535 f 0000000588 65535 f 0000000589 65535 f 0000000590 65535 f 0000000591 65535 f 0000000592 65535 f 0000000593 65535 f 0000000594 65535 f 0000000595 65535 f 0000000596 65535 f 0000000597 65535 f 0000000598 65535 f 0000000599 65535 f 0000000600 65535 f 0000000601 65535 f 0000000602 65535 f 0000000603 65535 f 0000000604 65535 f 0000000605 65535 f 0000000606 65535 f 0000000607 65535 f 0000000608 65535 f 0000000609 65535 f 0000000610 65535 f 0000000611 65535 f 0000000612 65535 f 0000000613 65535 f 0000000614 65535 f 0000000615 65535 f 0000000616 65535 f 0000000617 65535 f 0000000618 65535 f 0000000619 65535 f 0000000620 65535 f 0000000621 65535 f 0000000622 65535 f 0000000623 65535 f 0000000624 65535 f 0000000625 65535 f 0000000626 65535 f 0000000627 65535 f 0000000628 65535 f 0000000629 65535 f 0000000630 65535 f 0000000631 65535 f 0000000632 65535 f 0000000633 65535 f 0000000634 65535 f 0000000635 65535 f 0000000636 65535 f 0000000637 65535 f 0000000638 65535 f 0000000639 65535 f 0000000640 65535 f 0000000641 65535 f 0000000642 65535 f 0000000643 65535 f 0000000644 65535 f 0000000645 65535 f 0000000646 65535 f 0000000647 65535 f 0000000648 65535 f 0000000649 65535 f 0000000650 65535 f 0000000651 65535 f 0000000652 65535 f 0000000653 65535 f 0000000654 65535 f 0000000655 65535 f 0000000656 65535 f 0000000657 65535 f 0000000658 65535 f 0000000659 65535 f 0000000660 65535 f 0000000661 65535 f 0000000662 65535 f 0000000663 65535 f 0000000664 65535 f 0000000665 65535 f 0000000666 65535 f 0000000667 65535 f 0000000668 65535 f 0000000669 65535 f 0000000670 65535 f 0000000671 65535 f 0000000672 65535 f 0000000673 65535 f 0000000674 65535 f 0000000675 65535 f 0000000676 65535 f 0000000677 65535 f 0000000678 65535 f 0000000679 65535 f 0000000680 65535 f 0000000681 65535 f 0000000682 65535 f 0000000683 65535 f 0000000684 65535 f 0000000685 65535 f 0000000686 65535 f 0000000687 65535 f 0000000688 65535 f 0000000689 65535 f 0000000690 65535 f 0000000691 65535 f 0000000692 65535 f 0000000693 65535 f 0000000694 65535 f 0000000695 65535 f 0000000696 65535 f 0000000697 65535 f 0000000698 65535 f 0000000699 65535 f 0000000700 65535 f 0000000701 65535 f 0000000702 65535 f 0000000703 65535 f 0000000704 65535 f 0000000705 65535 f 0000000706 65535 f 0000000707 65535 f 0000000708 65535 f 0000000709 65535 f 0000000710 65535 f 0000000711 65535 f 0000000712 65535 f 0000000713 65535 f 0000000714 65535 f 0000000715 65535 f 0000000716 65535 f 0000000717 65535 f 0000000718 65535 f 0000000719 65535 f 0000000720 65535 f 0000000721 65535 f 0000000722 65535 f 0000000723 65535 f 0000000724 65535 f 0000000725 65535 f 0000000726 65535 f 0000000727 65535 f 0000000728 65535 f 0000000729 65535 f 0000000730 65535 f 0000000731 65535 f 0000000732 65535 f 0000000733 65535 f 0000000734 65535 f 0000000735 65535 f 0000000736 65535 f 0000000737 65535 f 0000000738 65535 f 0000000739 65535 f 0000000740 65535 f 0000000741 65535 f 0000000742 65535 f 0000000743 65535 f 0000000744 65535 f 0000000745 65535 f 0000000746 65535 f 0000000747 65535 f 0000000748 65535 f 0000000749 65535 f 0000000750 65535 f 0000000751 65535 f 0000000752 65535 f 0000000753 65535 f 0000000754 65535 f 0000000755 65535 f 0000000756 65535 f 0000000757 65535 f 0000000758 65535 f 0000000759 65535 f 0000000760 65535 f 0000000761 65535 f 0000000762 65535 f 0000000763 65535 f 0000000764 65535 f 0000000765 65535 f 0000000766 65535 f 0000000767 65535 f 0000000768 65535 f 0000000769 65535 f 0000000770 65535 f 0000000771 65535 f 0000000772 65535 f 0000000773 65535 f 0000000774 65535 f 0000000775 65535 f 0000000776 65535 f 0000000777 65535 f 0000000778 65535 f 0000000779 65535 f 0000000780 65535 f 0000000781 65535 f 0000000782 65535 f 0000000783 65535 f 0000000784 65535 f 0000000785 65535 f 0000000786 65535 f 0000000787 65535 f 0000000788 65535 f 0000000789 65535 f 0000000790 65535 f 0000000791 65535 f 0000000792 65535 f 0000000793 65535 f 0000000794 65535 f 0000000795 65535 f 0000000796 65535 f 0000000797 65535 f 0000000798 65535 f 0000000799 65535 f 0000000800 65535 f 0000000801 65535 f 0000000802 65535 f 0000000803 65535 f 0000000804 65535 f 0000000805 65535 f 0000000806 65535 f 0000000807 65535 f 0000000808 65535 f 0000000809 65535 f 0000000810 65535 f 0000000811 65535 f 0000000812 65535 f 0000000813 65535 f 0000000814 65535 f 0000000815 65535 f 0000000816 65535 f 0000000817 65535 f 0000000818 65535 f 0000000819 65535 f 0000000820 65535 f 0000000821 65535 f 0000000822 65535 f 0000000823 65535 f 0000000824 65535 f 0000000825 65535 f 0000000826 65535 f 0000000827 65535 f 0000000828 65535 f 0000000829 65535 f 0000000830 65535 f 0000000831 65535 f 0000000832 65535 f 0000000833 65535 f 0000000834 65535 f 0000000835 65535 f 0000000836 65535 f 0000000837 65535 f 0000000838 65535 f 0000000839 65535 f 0000000840 65535 f 0000000841 65535 f 0000000842 65535 f 0000000843 65535 f 0000000844 65535 f 0000000845 65535 f 0000000846 65535 f 0000000847 65535 f 0000000848 65535 f 0000000849 65535 f 0000000850 65535 f 0000000851 65535 f 0000000852 65535 f 0000000853 65535 f 0000000854 65535 f 0000000855 65535 f 0000000856 65535 f 0000000857 65535 f 0000000858 65535 f 0000000859 65535 f 0000000860 65535 f 0000000861 65535 f 0000000862 65535 f 0000000863 65535 f 0000000864 65535 f 0000000865 65535 f 0000000866 65535 f 0000000867 65535 f 0000000868 65535 f 0000000869 65535 f 0000000870 65535 f 0000000871 65535 f 0000000872 65535 f 0000000873 65535 f 0000000874 65535 f 0000000875 65535 f 0000000876 65535 f 0000000877 65535 f 0000000878 65535 f 0000000879 65535 f 0000000880 65535 f 0000000881 65535 f 0000000882 65535 f 0000000883 65535 f 0000000884 65535 f 0000000885 65535 f 0000000886 65535 f 0000000887 65535 f 0000000888 65535 f 0000000889 65535 f 0000000890 65535 f 0000000891 65535 f 0000000892 65535 f 0000000893 65535 f 0000000894 65535 f 0000000895 65535 f 0000000896 65535 f 0000000000 65535 f 0000041799 00000 n 0000042004 00000 n 0000046059 00000 n 0000168029 00000 n 0000168063 00000 n 0000168434 00000 n 0000218479 00000 n 0000218692 00000 n 0000218858 00000 n 0000218886 00000 n 0000219230 00000 n 0000300472 00000 n 0000300595 00000 n 0000300695 00000 n 0000300723 00000 n trailer <] >> startxref 302702 %%eof xref 0 0 trailer <] /prev 302702/xrefstm 300723>> startxref 321103 %%eof